LXL04_021904 | RubberDandelionOmics

Gene overview

LXL04_021904

Reference: OH-1004 Chr: Chr04 Coordinates: 139945167-139955114 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4278 bp · LXL04_021904|LXL04_021904|OH1004|cDNA

atggcttcttcttcatcttcgtACAAACAGTTTGAGCACTTACCAATCCCAATTGCAGATATAGCATGCGCCACAGACAATTTTTCTGATGCAAACCTCATCAGAGAAGGTAGATTTGGAAAGCACTACAAAGGAAAACTCAACCACTTGGGGAAATTAATTGACATTGTTGCACGAAGGTTGGATCCTAAGAACGAGTATGGATATCTAGAGTTCTGGATGGAGGTTACGATGCTTTCCACACTCAAGCATGACAACCT...

CDS

Download CDS FASTA

4278 bp · LXL04_021904|LXL04_021904|OH1004|CDS

ATGGCTTCTTCTTCATCTTCGTACAAACAGTTTGAGCACTTACCAATCCCAATTGCAGATATAGCATGCGCCACAGACAATTTTTCTGATGCAAACCTCATCAGAGAAGGTAGATTTGGAAAGCACTACAAAGGAAAACTCAACCACTTGGGGAAATTAATTGACATTGTTGCACGAAGGTTGGATCCTAAGAACGAGTATGGATATCTAGAGTTCTGGATGGAGGTTACGATGCTTTCCACACTCAAGCATGACAACCT...

Protein

Download Protein FASTA

1425 aa · LXL04_021904|LXL04_021904|OH1004|PROTEIN

MASSSSSYKQFEHLPIPIADIACATDNFSDANLIREGRFGKHYKGKLNHLGKLIDIVARRLDPKNEYGYLEFWMEVTMLSTLKHDNLVSMIGFCDDNDVNIVVNKHEAKGSLDQYLSDPITLTWTRRLEVCVGMANTLRYIHYDPKRNFSVVHRDIKSSKILLDDKWKPKLSGFELAMKIAASQRGEVHSDYACGTRGYIDPIYMETGRVSHKSDVYSFGVVLFEIMCGTTALITSDLVKKVLEKLDHGSLEVEAKLDDE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021904`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021904

Location Chr04:139945167-139955114 (-)

Description Similar to At5g39000: Putative receptor-like protein kinase At5g39000

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g39000`	Putative receptor-like protein kinase At5g39000.	No verified direct reference in this release
`At5g38990`	Probable receptor-like protein kinase At5g38990.	No verified direct reference in this release
`At3g46290`	Receptor-like protein kinase required for cell elongation during vegetative growth, mostly in a brassinosteroid-(BR-) independent manner.	Three related receptor-like kinases are required for optimal cell elongation in Arabidopsis thaliana.2009 · DOI: 10.1073/pnas.0812346106
`At5g59700`	Probable receptor-like protein kinase At5g59700.	No verified direct reference in this release
`At5g28680`	Receptor-like protein kinase that controls pollen tube behavior by directing rupture at proper timing to release the sperm cell.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021904 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010038 response to metal ion Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004714 transmembrane receptor protein tyrosine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT5G38990

ath:AT5G39000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.473

Rank 1 · LXL04_021904 · OH-1004

Cell membrane0.341

Rank 2 · LXL04_021904 · OH-1004

Nucleus0.285

Rank 3 · LXL04_021904 · OH-1004

Endoplasmic reticulum0.062

Rank 4 · LXL04_021904 · OH-1004

Lysosome / Vacuole0.049

Rank 5 · LXL04_021904 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase33-340 aa

PF07714.24PK_Tyr_Ser-Thr34-246 aa

PF07714.24PK_Tyr_Ser-Thr393-666 aa

PF00069.32Pkinase432-642 aa

PF07714.24PK_Tyr_Ser-Thr698-967 aa

PF00069.32Pkinase698-968 aa

PF14299.14PP21056-1180 aa

PF14299.14PP21268-1424 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021904	`PF00069.32`	Pkinase	33	340	7.2e-103	344.3
LXL04_021904	`PF07714.24`	PK_Tyr_Ser-Thr	34	246	2.2e-108	362.2
LXL04_021904	`PF07714.24`	PK_Tyr_Ser-Thr	393	666	2.2e-108	362.2
LXL04_021904	`PF00069.32`	Pkinase	432	642	7.2e-103	344.3
LXL04_021904	`PF07714.24`	PK_Tyr_Ser-Thr	698	967	2.2e-108	362.2
LXL04_021904	`PF00069.32`	Pkinase	698	968	7.2e-103	344.3
LXL04_021904	`PF14299.14`	PP2	1056	1180	5e-38	131.1
LXL04_021904	`PF14299.14`	PP2	1268	1424	5e-38	131.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FID8`	Arabidopsis thaliana	Putative receptor-like protein kinase At5g39000	38.436%	Swiss-Prot	weak database homology
`Q9FID9`	Arabidopsis thaliana	Probable receptor-like protein kinase At5g38990	36.808%	Swiss-Prot	weak database homology
`Q9LX66`	Arabidopsis thaliana	Receptor-like protein kinase HERK 1	36.928%	Swiss-Prot	weak database homology
`Q9FN92`	Arabidopsis thaliana	Probable receptor-like protein kinase At5g59700	37.294%	Swiss-Prot	weak database homology
`Q3E8W4`	Arabidopsis thaliana	Receptor-like protein kinase ANXUR2	36.306%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card