LXL04_010836 | RubberDandelionOmics

Gene overview

LXL04_010836

Reference: OH-1004 Chr: Chr02 Coordinates: 154293548-154294906 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1359 bp · LXL04_010836|LXL04_010836|OH1004|cDNA

ATGAATGACTTAATTCTCTCaccatcttcatcttcttccatTGTCTCCTTTCACAATGTCACCACTCCTTCCCCTTCAGATACCCTCCTGCAAAAGCTTCAACACCTCCTTCAAAACCAACCTCAACCATGGGCATACGCCATTTTCTGGCAGACCTTCAACGATTACGCCAATGGCTGTGTCTCCTTGTCCTGGGGTGACGGCCATTTCCAAAACATCAACTCCGACCTAACCCCCACCACCATGAGCTCCGCCACCTT...

CDS

Download CDS FASTA

1359 bp · LXL04_010836|LXL04_010836|OH1004|CDS

ATGAATGACTTAATTCTCTCACCATCTTCATCTTCTTCCATTGTCTCCTTTCACAATGTCACCACTCCTTCCCCTTCAGATACCCTCCTGCAAAAGCTTCAACACCTCCTTCAAAACCAACCTCAACCATGGGCATACGCCATTTTCTGGCAGACCTTCAACGATTACGCCAATGGCTGTGTCTCCTTGTCCTGGGGTGACGGCCATTTCCAAAACATCAACTCCGACCTAACCCCCACCACCATGAGCTCCGCCACCTT...

Protein

Download Protein FASTA

452 aa · LXL04_010836|LXL04_010836|OH1004|PROTEIN

MNDLILSPSSSSSIVSFHNVTTPSPSDTLLQKLQHLLQNQPQPWAYAIFWQTFNDYANGCVSLSWGDGHFQNINSDLTPTTMSSATFLSNSDHNTDGRVSVLREMQALLGPDNHDDAEWFYVISLTRSFTQGDGSVPATAFGSNSMIWLSGIDQLKSFNCDRSKEAQIHGLVTLACVPTPNGVVEMGSYHVIEESWNLAHQVQSLFGCGSTSSSCSPRDPIPKKITDFESSTPDNQTKDGSLCMKRNTAVVKNTYVESTG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010836`
TK1151 ID	TkA03G551260
OH-1004 ID	LXL04_010836
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	66.200
Protein coverage (%)	TK1151 89.759 / OH-1004 98.894 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010836

Location Chr02:154293548-154294906 (+)

Description Similar to MYC4: Transcription factor MYC4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g17880`	Transcription factor involved in jasmonic acid (JA) gene regulation.	Characterization of JAZ-interacting bHLH transcription factors that regulate jasmonate responses in Arabidopsis.2011 · DOI: 10.1093/jxb/erq408 The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses.2011 · DOI: 10.1105/tpc.110.080788 Arabidopsis basic helix-loop-helix transcription factors MYC2, MYC3, and MYC4 regulate glucosinolate biosynthesis, insect performance, and feeding behavior.2013 · DOI: 10.1105/tpc.113.115139
`At4g00870`	Transcription factor bHLH14.	No verified direct reference in this release
`At5g46830`	Transcription factor bHLH28.	No verified direct reference in this release
`At4g16430`	Transcription factor bHLH3.	No verified direct reference in this release
`At1g32640`	Transcriptional activator.	Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling.2003 · DOI: 10.1105/tpc.006130 JASMONATE-INSENSITIVE1 encodes a MYC transcription factor essential to discriminate between different jasmonate-regulated defense responses in Arabidopsis.2004 · DOI: 10.1105/tpc.022319 A basic helix-loop-helix transcription factor in Arabidopsis, MYC2, acts as a repressor of blue light-mediated photomorphogenic growth.2005 · DOI: 10.1105/tpc.105.032060 Characterization of JAZ-interacting bHLH transcription factors that regulate jasmonate responses in Arabidopsis.2011 · DOI: 10.1093/jxb/erq408 The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses.2011 · DOI: 10.1105/tpc.110.080788 The basic helix-loop-helix transcription factor MYC2 directly represses PLETHORA expression during jasmonate-mediated modulation of the root stem cell niche in Arabidopsis.2011 · DOI: 10.1105/tpc.111.089870 Arabidopsis MYC2 interacts with DELLA proteins in regulating sesquiterpene synthase gene expression.2012 · DOI: 10.1105/tpc.112.098749 Arabidopsis basic helix-loop-helix transcription factors MYC2, MYC3, and MYC4 regulate glucosinolate biosynthesis, insect performance, and feeding behavior.2013 · DOI: 10.1105/tpc.113.115139 Role of arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression.1997 · DOI: 10.1105/tpc.9.10.1859

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010836 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006568 L-tryptophan metabolic process Biological Process

GO:0006952 defense response Biological Process

GO:0009269 response to desiccation Biological Process

GO:0009611 response to wounding Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009718 anthocyanin-containing compound biosynthetic process Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0009759 indole glucosinolate biosynthetic process Biological Process

KEGG gene cross-reference

ath:AT1G32640

ath:AT4G00870

ath:AT4G16430

ath:AT4G17880

ath:AT5G46830

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.897

Rank 1 · LXL04_010836 · OH-1004

Cytoplasm0.167

Rank 2 · LXL04_010836 · OH-1004

Cell membrane0.053

Rank 3 · LXL04_010836 · OH-1004

Endoplasmic reticulum0.033

Rank 4 · LXL04_010836 · OH-1004

Plastid0.015

Rank 5 · LXL04_010836 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14215.13bHLH-MYC_N30-206 aa

PF00010.32HLH297-342 aa

PF23177.2bHLH_IRO3300-372 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010836	`PF14215.13`	bHLH-MYC_N	30	206	3.4e-39	135.7
LXL04_010836	`PF00010.32`	HLH	297	342	5e-12	46.2
LXL04_010836	`PF23177.2`	bHLH_IRO3	300	372	1.3e-09	39.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O49687`	Arabidopsis thaliana	Transcription factor MYC4	31.783%	Swiss-Prot	moderate database homology
`O23090`	Arabidopsis thaliana	Transcription factor bHLH14	35.731%	Swiss-Prot	moderate database homology
`Q9LUK7`	Arabidopsis thaliana	Transcription factor bHLH28	32.051%	Swiss-Prot	moderate database homology
`O23487`	Arabidopsis thaliana	Transcription factor bHLH3	34.054%	Swiss-Prot	moderate database homology
`Q39204`	Arabidopsis thaliana	Transcription factor MYC2	47.120%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card