TkA03G551260 | RubberDandelionOmics

Gene overview

TkA03G551260

Reference: TK1151 Chr: Chr03 Coordinates: 139574441-139575886 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

999 bp · TkA03G551260|TK1151|cDNA

ATGAATGACTTAATTCTCTCACCATCTTCATCTTCTTCCATTGTCTCCTTTCACAATGTCACCACTCCTTCCCCTTCAGATACCCTCCTGCAAAAGCTTCAACACCTCCTTCAAAACCAACCTCAACCATGGGCATACGCCATTTTCTGGCAGACCTTCAACGATTACGCCAATGGCTGTGTCTCCTTGTCCTGGGGTGACGGCCATTTCCAAAACATCAACTCCGACCTAACCCCCACCAAAATGCAGGCCCTCCTTGG...

CDS

Download CDS FASTA

999 bp · TkA03G551260|TK1151|CDS

ATGAATGACTTAATTCTCTCACCATCTTCATCTTCTTCCATTGTCTCCTTTCACAATGTCACCACTCCTTCCCCTTCAGATACCCTCCTGCAAAAGCTTCAACACCTCCTTCAAAACCAACCTCAACCATGGGCATACGCCATTTTCTGGCAGACCTTCAACGATTACGCCAATGGCTGTGTCTCCTTGTCCTGGGGTGACGGCCATTTCCAAAACATCAACTCCGACCTAACCCCCACCAAAATGCAGGCCCTCCTTGG...

Protein

Download Protein FASTA

332 aa · TkA03G551260|TK1151|PROTEIN

MNDLILSPSSSSSIVSFHNVTTPSPSDTLLQKLQHLLQNQPQPWAYAIFWQTFNDYANGCVSLSWGDGHFQNINSDLTPTKMQALLGPDNHDDAEWFYVISLTRSFTQGDGSVPATAFGSNSMIWLSNTYVESTGDSDQSDSDCQLVLATTGKRIQKKNVNHVEAERQRREKLNQRFYALRSVVPNVSRMDKASLLADAVCYIKELNEKVESLESELNHRNKQLKHKKVKVEMTETMYKSTKQSSKINNKPSDFKEIEVK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G551260`
TK1151 ID	TkA03G551260
OH-1004 ID	LXL04_010836
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	66.200
Protein coverage (%)	TK1151 89.759 / OH-1004 98.894 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G551260

Location Chr03:139574441-139575886 (+)

Description Similar to MYC4: Transcription factor MYC4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g32640`	Transcriptional activator.	Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling.2003 · DOI: 10.1105/tpc.006130 JASMONATE-INSENSITIVE1 encodes a MYC transcription factor essential to discriminate between different jasmonate-regulated defense responses in Arabidopsis.2004 · DOI: 10.1105/tpc.022319 A basic helix-loop-helix transcription factor in Arabidopsis, MYC2, acts as a repressor of blue light-mediated photomorphogenic growth.2005 · DOI: 10.1105/tpc.105.032060 Characterization of JAZ-interacting bHLH transcription factors that regulate jasmonate responses in Arabidopsis.2011 · DOI: 10.1093/jxb/erq408 The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses.2011 · DOI: 10.1105/tpc.110.080788 The basic helix-loop-helix transcription factor MYC2 directly represses PLETHORA expression during jasmonate-mediated modulation of the root stem cell niche in Arabidopsis.2011 · DOI: 10.1105/tpc.111.089870 Arabidopsis MYC2 interacts with DELLA proteins in regulating sesquiterpene synthase gene expression.2012 · DOI: 10.1105/tpc.112.098749 Arabidopsis basic helix-loop-helix transcription factors MYC2, MYC3, and MYC4 regulate glucosinolate biosynthesis, insect performance, and feeding behavior.2013 · DOI: 10.1105/tpc.113.115139 Role of arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression.1997 · DOI: 10.1105/tpc.9.10.1859
`At4g00870`	Transcription factor bHLH14.	No verified direct reference in this release
`At5g46760`	Transcription factor involved in tryptophan, jasmonic acid (JA) and other stress-responsive gene regulation.	The bHLH transcription factor MYC3 interacts with the Jasmonate ZIM-domain proteins to mediate jasmonate response in Arabidopsis.2011 · DOI: 10.1093/mp/ssq073 Characterization of JAZ-interacting bHLH transcription factors that regulate jasmonate responses in Arabidopsis.2011 · DOI: 10.1093/jxb/erq408 The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses.2011 · DOI: 10.1105/tpc.110.080788 Arabidopsis basic helix-loop-helix transcription factors MYC2, MYC3, and MYC4 regulate glucosinolate biosynthesis, insect performance, and feeding behavior.2013 · DOI: 10.1105/tpc.113.115139
`At4g17880`	Transcription factor involved in jasmonic acid (JA) gene regulation.	Characterization of JAZ-interacting bHLH transcription factors that regulate jasmonate responses in Arabidopsis.2011 · DOI: 10.1093/jxb/erq408 The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses.2011 · DOI: 10.1105/tpc.110.080788 Arabidopsis basic helix-loop-helix transcription factors MYC2, MYC3, and MYC4 regulate glucosinolate biosynthesis, insect performance, and feeding behavior.2013 · DOI: 10.1105/tpc.113.115139

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010836 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006568 L-tryptophan metabolic process Biological Process

GO:0006952 defense response Biological Process

GO:0009269 response to desiccation Biological Process

GO:0009611 response to wounding Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009718 anthocyanin-containing compound biosynthetic process Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0009759 indole glucosinolate biosynthetic process Biological Process

KEGG gene cross-reference

ath:AT1G32640

ath:AT4G00870

ath:AT4G16430

ath:AT4G17880

ath:AT5G46830

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.899

Rank 1 · TkA03G551260 · TK1151

Cytoplasm0.187

Rank 2 · TkA03G551260 · TK1151

Cell membrane0.042

Rank 3 · TkA03G551260 · TK1151

Endoplasmic reticulum0.029

Rank 4 · TkA03G551260 · TK1151

Plastid0.012

Rank 5 · TkA03G551260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14215bHLH-MYC_N30-132 aa

PF29090PEA2_C148-171 aa

PF06050HGD-D150-308 aa

PF16046FAM76153-251 aa

PF26666DUF8221158-168 aa

PF23181bHLH_INO4159-225 aa

PF23179bHLH_INO2159-216 aa

PF00010HLH160-206 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G551260	`PF14215`	bHLH-MYC_N	30	132	1.2e-15	59.0
TkA03G551260	`PF29090`	PEA2_C	148	171	0.25	12.1
TkA03G551260	`PF06050`	HGD-D	150	308	0.0042	17.3
TkA03G551260	`PF16046`	FAM76	153	251	1.4	9.0
TkA03G551260	`PF26666`	DUF8221	158	168	0.003	18.3
TkA03G551260	`PF23181`	bHLH_INO4	159	225	0.016	16.0
TkA03G551260	`PF23179`	bHLH_INO2	159	216	0.04	14.8
TkA03G551260	`PF00010`	HLH	160	206	2.5e-12	47.1
TkA03G551260	`PF03961`	FapA	160	246	1.5	9.1
TkA03G551260	`PF23177`	bHLH_IRO3	162	233	1.4e-08	35.7
TkA03G551260	`PF23173`	bHLH_SAC51	166	213	1.9e-05	25.2
TkA03G551260	`PF03954`	Lectin_N	170	228	0.03	14.9
TkA03G551260	`PF14215`	bHLH-MYC_N	201	243	1.2e-15	59.0
TkA03G551260	`PF29090`	PEA2_C	202	280	0.25	12.1
TkA03G551260	`PF26666`	DUF8221	203	248	0.003	18.3
TkA03G551260	`PF18323`	CSN5_C	203	250	0.43	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q39204`	Arabidopsis thaliana	sp\|Q39204\|MYC2_ARATH Transcription factor MYC2	44.200%	Swiss-Prot	Medium
`O23090`	Arabidopsis thaliana	sp\|O23090\|BH014_ARATH Transcription factor bHLH14	45.200%	Swiss-Prot	Medium
`Q9FIP9`	Arabidopsis thaliana	sp\|Q9FIP9\|MYC3_ARATH Transcription factor MYC3	38.500%	Swiss-Prot	Medium
`O49687`	Arabidopsis thaliana	sp\|O49687\|MYC4_ARATH Transcription factor MYC4	44.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card