LXL04_010678 | RubberDandelionOmics

Gene overview

LXL04_010678

Reference: OH-1004 Chr: Chr02 Coordinates: 151417761-151421021 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1659 bp · LXL04_010678|LXL04_010678|OH1004|cDNA

ATGGCAGCGGCTAAGGATCTCAAAACCCCTTTACTCCCTGCTTCCGATGATCAACTTCATGGCCCCCAACTCATCCTAGACGTCGATGATCATCCGGATCCTTCCGCATCTGCGAATCAATGTTCAATTTCTATCAACACCCAATTGGATTTCGATGAAAACCCATACGCGTTTATCGGGTCAAACGGGTTTGAAGTTCCCGGGTCAACCACTGTGGATCCGTTTAGGAACCATACACCCAGAATCGAAGGGGTTTATGA...

CDS

Download CDS FASTA

1659 bp · LXL04_010678|LXL04_010678|OH1004|CDS

ATGGCAGCGGCTAAGGATCTCAAAACCCCTTTACTCCCTGCTTCCGATGATCAACTTCATGGCCCCCAACTCATCCTAGACGTCGATGATCATCCGGATCCTTCCGCATCTGCGAATCAATGTTCAATTTCTATCAACACCCAATTGGATTTCGATGAAAACCCATACGCGTTTATCGGGTCAAACGGGTTTGAAGTTCCCGGGTCAACCACTGTGGATCCGTTTAGGAACCATACACCCAGAATCGAAGGGGTTTATGA...

Protein

Download Protein FASTA

552 aa · LXL04_010678|LXL04_010678|OH1004|PROTEIN

MAAAKDLKTPLLPASDDQLHGPQLILDVDDHPDPSASANQCSISINTQLDFDENPYAFIGSNGFEVPGSTTVDPFRNHTPRIEGVYECVKVLVCAPIALLRLVLFAFCLAVGYLATKFALHGWKDKHNPMPKWRCRVMWITRLCTRGILFAFGYHWIQRKGKPAPREIAPIIVSNHVSYIDPIFFFYELFPTIVASESHDSMPFVGTIIRAMQVIYVDRFSQQSRKHAVNEIKRKASSDRFPRLLLFPEGTTTNGRMLIS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010678`
TK1151 ID	TkA03G542820
OH-1004 ID	LXL04_010678
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 53.623 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010678

Location Chr02:151417761-151421021 (-)

Description Similar to LPEAT2: Lysophospholipid acyltransferase LPEAT2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g45670`	Possesses acyl-CoA-dependent lysophospholipid acyltransferase activity with a subset of lysophospholipids as substrates.	Characterization of two Arabidopsis thaliana acyltransferases with preference for lysophosphatidylethanolamine.2009 · DOI: 10.1186/1471-2229-9-60 Acyl-CoA:Lysophosphatidylethanolamine Acyltransferase Activity Regulates Growth of Arabidopsis.2017 · DOI: 10.1104/pp.17.00391

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010678 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000038 very long-chain fatty acid metabolic process Biological Process

GO:0006644 phospholipid metabolic process Biological Process

GO:0006654 phosphatidic acid biosynthetic process Biological Process

GO:0008654 phospholipid biosynthetic process Biological Process

GO:0030258 lipid modification Biological Process

GO:0036148 phosphatidylglycerol acyl-chain remodeling Biological Process

GO:0036151 phosphatidylcholine acyl-chain remodeling Biological Process

GO:0043129 surfactant homeostasis Biological Process

GO:0045732 positive regulation of protein catabolic process Biological Process

GO:2001246 negative regulation of phosphatidylcholine biosynthetic process Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

KEGG gene cross-reference

ath:AT2G45670

dme:Dmel_CG32699

hsa:79888

mmu:210992

rno:361467

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.342

Rank 1 · LXL04_010678 · OH-1004

Golgi apparatus0.238

Rank 2 · LXL04_010678 · OH-1004

Cell membrane0.164

Rank 3 · LXL04_010678 · OH-1004

Cytoplasm0.150

Rank 4 · LXL04_010678 · OH-1004

Lysosome / Vacuole0.127

Rank 5 · LXL04_010678 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01553.27Acyltransferase164-277 aa

PF13499.13EF-hand_7460-518 aa

PF13833.13EF-hand_8484-522 aa

PF13405.13EF-hand_6499-522 aa

PF00036.39EF-hand_1499-522 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010678	`PF01553.27`	Acyltransferase	164	277	3.4e-19	69.7
LXL04_010678	`PF13499.13`	EF-hand_7	460	518	2.7e-08	34.7
LXL04_010678	`PF13833.13`	EF-hand_8	484	522	2.7e-06	27.7
LXL04_010678	`PF13405.13`	EF-hand_6	499	522	6.7e-09	35.4
LXL04_010678	`PF00036.39`	EF-hand_1	499	522	5.8e-07	29.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S8S2`	Arabidopsis thaliana	Lysophospholipid acyltransferase LPEAT2	63.060%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card