LXL04_008351 | RubberDandelionOmics

Gene overview

LXL04_008351

Reference: OH-1004 Chr: Chr02 Coordinates: 97081165-97085982 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2490 bp · LXL04_008351|LXL04_008351|OH1004|cDNA

ATGGGGGATATAACTAGCACCGGTGCTGGAGATGAACAGAGAGCAGTGAAGCTTCCGATTGCTGGCAAAAGAAACATCCTCATCACCAGTGCTCTCCCTTATGTCAACAACGTTCCGCACCTTGGAAACATCATTGGATGTGTGTTGAGTGCTGATGTGTTTGCTCGCTATTGTCGATTGAGGGGATACAACGCCATATACATATGTGGCACTGATGAGTACGGAACAGCTACAGAGACCAAAGCCTTGGAAGAAAATTC...

CDS

Download CDS FASTA

2490 bp · LXL04_008351|LXL04_008351|OH1004|CDS

ATGGGGGATATAACTAGCACCGGTGCTGGAGATGAACAGAGAGCAGTGAAGCTTCCGATTGCTGGCAAAAGAAACATCCTCATCACCAGTGCTCTCCCTTATGTCAACAACGTTCCGCACCTTGGAAACATCATTGGATGTGTGTTGAGTGCTGATGTGTTTGCTCGCTATTGTCGATTGAGGGGATACAACGCCATATACATATGTGGCACTGATGAGTACGGAACAGCTACAGAGACCAAAGCCTTGGAAGAAAATTC...

Protein

Download Protein FASTA

829 aa · LXL04_008351|LXL04_008351|OH1004|PROTEIN

MGDITSTGAGDEQRAVKLPIAGKRNILITSALPYVNNVPHLGNIIGCVLSADVFARYCRLRGYNAIYICGTDEYGTATETKALEENSTPKEICDKYHAIHRDVYKWFNISFDEFGRTSSPQQTEVCQAIFNKLLENNWLSENTMQQLYCDTCSKFLADRLVEGSCPTPGCNYDSARGDQCENCGKLLNPTELINPRCKVCKSSPRIRDTDHLFLELPLLESKLRDYISTMSVAGSWSQNAIHATNAWLKEGLRQRCITRD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008351`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008351

Location Chr02:97081165-97085982 (+)

Description Similar to Os06g0508700: Probable methionine--tRNA ligase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g13780`	Methionine--tRNA ligase, cytoplasmic.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0508700`	Probable methionine--tRNA ligase.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008351 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006431 methionyl-tRNA aminoacylation Biological Process

GO:0009303 rRNA transcription Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0036120 cellular response to platelet-derived growth factor stimulus Biological Process

GO:0048608 reproductive structure development Biological Process

GO:0071364 cellular response to epidermal growth factor stimulus Biological Process

GO:1901838 positive regulation of transcription of nucleolar large rRNA by RNA polymerase I Biological Process

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0017101 aminoacyl-tRNA synthetase multienzyme complex Cellular Component

KEGG gene cross-reference

ath:AT4G13780

ddi:DDB_G0279113

mmu:216443

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.750

Rank 1 · LXL04_008351 · OH-1004

Nucleus0.267

Rank 2 · LXL04_008351 · OH-1004

Mitochondrion0.106

Rank 3 · LXL04_008351 · OH-1004

Peroxisome0.061

Rank 4 · LXL04_008351 · OH-1004

Cell membrane0.055

Rank 5 · LXL04_008351 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09334.18tRNA-synt_1g26-420 aa

PF00133.29tRNA-synt_126-269 aa

PF19303.6Anticodon_3448-530 aa

PF01588.27tRNA_bind675-767 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008351	`PF09334.18`	tRNA-synt_1g	26	420	7.4e-155	516.2
LXL04_008351	`PF00133.29`	tRNA-synt_1	26	269	1.8e-10	40.9
LXL04_008351	`PF19303.6`	Anticodon_3	448	530	3.6e-15	56.9
LXL04_008351	`PF01588.27`	tRNA_bind	675	767	4e-31	107.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SVN5`	Arabidopsis thaliana	Methionine--tRNA ligase, cytoplasmic	72.397%	Swiss-Prot	strong database homology
`Q9ZTS1`	Oryza sativa subsp. japonica	Probable methionine--tRNA ligase	74.541%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card