TkAUNG097880 | RubberDandelionOmics

Gene overview

TkAUNG097880

Reference: TK1151 Chr: ChrUn Coordinates: 27651463-27652635 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1173 bp · TkAUNG097880|TK1151|cDNA

ATGTCATATCTTCAAGCTTCTAACTCACAAGATGAATCAATGTTTCAATATCCTTACTATCTTCACCAAGACTCAAACTTCAACCTTCCATCAATTCCAATCATCACATCACAACCCCATCTCCCATATTACCACTGCATCGCCACCATCAAATGCAACAACTCCTATATCTCCTCACTTGCCATTTATGGAAACTCACTATATACCGGATCTTCCAACAAAGAAATCCGTATATGGAAACTAGACACCATAAAATCACA...

CDS

Download CDS FASTA

1173 bp · TkAUNG097880|TK1151|CDS

ATGTCATATCTTCAAGCTTCTAACTCACAAGATGAATCAATGTTTCAATATCCTTACTATCTTCACCAAGACTCAAACTTCAACCTTCCATCAATTCCAATCATCACATCACAACCCCATCTCCCATATTACCACTGCATCGCCACCATCAAATGCAACAACTCCTATATCTCCTCACTTGCCATTTATGGAAACTCACTATATACCGGATCTTCCAACAAAGAAATCCGTATATGGAAACTAGACACCATAAAATCACA...

Protein

Download Protein FASTA

390 aa · TkAUNG097880|TK1151|PROTEIN

MSYLQASNSQDESMFQYPYYLHQDSNFNLPSIPIITSQPHLPYYHCIATIKCNNSYISSLAIYGNSLYTGSSNKEIRIWKLDTIKSQFNQEHQSESIVVVTGEGAIKSLVISSDKIFSAHQDHKIRVWKLEGQDRKFTHVATLPTFGDRALKILTPRNHVQVRRNKTSTWVHHVDTVSGLALSRDGLVIYSVSWDRTLKIWRTSDFKCVESVANAHDDAINTVVVSSNGDVYTGSSDKKIKTWRKSEEKHNHILIATLKK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG097880`
TK1151 ID	TkAUNG097880
OH-1004 ID	LXL04_009592
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	97.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG097880

Location ChrUn:27651463-27652635 (+)

Description Similar to JGB: Protein JINGUBANG

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g26490`	Negative regulator of pollen germination.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009592 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009846 pollen germination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0035097 histone methyltransferase complex Cellular Component

GO:0004197 cysteine-type endopeptidase activity Molecular Function

GO:0005525 GTP binding Molecular Function

KEGG gene cross-reference

ana:all2124

ath:AT2G26490

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.552

Rank 1 · TkAUNG097880 · TK1151

Cytoplasm0.363

Rank 2 · TkAUNG097880 · TK1151

Cell membrane0.089

Rank 3 · TkAUNG097880 · TK1151

Lysosome / Vacuole0.057

Rank 4 · TkAUNG097880 · TK1151

Endoplasmic reticulum0.037

Rank 5 · TkAUNG097880 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25173Beta-prop_WDR3_1st43-81 aa

PF24807WD40_CDC20-Fz45-135 aa

PF00400WD4046-79 aa

PF25172Beta-prop_WDR3_2nd46-90 aa

PF25391WD40_Gbeta46-133 aa

PF23760Beta-prop_DCAF1246-101 aa

PF25171Beta-prop_WDR36-Utp21_1st49-289 aa

PF03478Beta-prop_KIB1-449-151 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG097880	`PF25173`	Beta-prop_WDR3_1st	43	81	2.5e-28	99.7
TkAUNG097880	`PF24807`	WD40_CDC20-Fz	45	135	2.2e-17	64.0
TkAUNG097880	`PF00400`	WD40	46	79	5.6e-36	122.2
TkAUNG097880	`PF25172`	Beta-prop_WDR3_2nd	46	90	2.9e-23	83.2
TkAUNG097880	`PF25391`	WD40_Gbeta	46	133	8.9e-13	48.6
TkAUNG097880	`PF23760`	Beta-prop_DCAF12	46	101	0.0026	17.5
TkAUNG097880	`PF25171`	Beta-prop_WDR36-Utp21_1st	49	289	1.9e-08	34.8
TkAUNG097880	`PF03478`	Beta-prop_KIB1-4	49	151	0.0013	19.0
TkAUNG097880	`PF23775`	Beta-prop_RIG_2nd	50	138	0.15	12.1
TkAUNG097880	`PF24017`	Beta-prop_SCAP	53	208	2e-13	50.7
TkAUNG097880	`PF25048`	Beta-prop_TEP1_C	55	85	1.9e-18	67.0
TkAUNG097880	`PF20426`	NBCH_WD40	58	93	2.1e-07	30.9
TkAUNG097880	`PF25175`	Beta-prop_WDR5	63	230	1.2e-31	110.8
TkAUNG097880	`PF25174`	Beta-prop_THOC3	63	133	9.5e-26	91.1
TkAUNG097880	`PF23381`	Beta-prop_IFT122_1st	63	133	5.3e-23	82.5
TkAUNG097880	`PF24782`	WD40_MABP1-WDR62_2nd	63	90	1.1e-06	28.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O48716`	Arabidopsis thaliana	sp\|O48716\|JGB_ARATH Protein JINGUBANG	40.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card