TkAUNG096510 | RubberDandelionOmics

Gene overview

TkAUNG096510

Reference: TK1151 Chr: ChrUn Coordinates: 27283217-27287069 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1217 bp · TkAUNG096510|TK1151|cDNA

CTTAGGTCTCGCCTCGGTAGCGATTGTAATATATGCGAATCTTTGACTTCAGGTCCATCTCACGCCATAGACATAACACGAGAGGCAATACGTGAAGGTGCTGATGCAGTTGTTGCAGTTGGGGGCGATGGGACACTTCATGAGGTTGTGAATGGATTCTTTTGGGGTGGAAAACCAGTTACTAAACATGATTCAAAGGTTCCACGTACAACATCCCTTGGGTTGATCCCATTGGGAACTGGGTCAGATTTTGCAAGAAC...

CDS

Download CDS FASTA

864 bp · TkAUNG096510|TK1151|CDS

CTTAGGTCTCGCCTCGGTAGCGATTGTAATATATGCGAATCTTTGACTTCAGGTCCATCTCACGCCATAGACATAACACGAGAGGCAATACGTGAAGGTGCTGATGCAGTTGTTGCAGTTGGGGGCGATGGGACACTTCATGAGGTTGTGAATGGATTCTTTTGGGGTGGAAAACCAGTTACTAAACATGATTCAAAGGTTCCACGTACAACATCCCTTGGGTTGATCCCATTGGGAACTGGGTCAGATTTTGCAAGAAC...

Protein

Download Protein FASTA

287 aa · TkAUNG096510|TK1151|PROTEIN

LRSRLGSDCNICESLTSGPSHAIDITREAIREGADAVVAVGGDGTLHEVVNGFFWGGKPVTKHDSKVPRTTSLGLIPLGTGSDFARTFGWTNDPVDAIERLVKGSKSRIDVGVITKEGGDLHYFINVADIHLSAKAGYHASKYKRFGSLCYVIGALQAFFGHHNQDLKIKVNDGEWEVYPKVTALCIGNAKFFGGGMRITPNAHPSSGNFEVVTLQDFKWYDFIMKLHRLYNGTHLSVNNVLSRRAFSIQVEEVVGTNSI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG096510`
TK1151 ID	TkAUNG096510
OH-1004 ID	LXL04_022617
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 81.356 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG096510

Location ChrUn:27283217-27287069 (-)

Description Similar to LCKB2: Sphingoid long-chain bases kinase 2, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g46090`	Involved in the production of sphingoid long-chain base (LCB).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022617 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006665 sphingolipid metabolic process Biological Process

GO:0006671 phytosphingosine metabolic process Biological Process

GO:0008654 phospholipid biosynthetic process Biological Process

GO:0009247 glycolipid biosynthetic process Biological Process

GO:0009409 response to cold Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0004143 ATP-dependent diacylglycerol kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0008481 sphingosine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT2G46090

mtu:Rv2252

mtv:RVBD_2252

sca:SCA_1470

ssp:SSP0893

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.449

Rank 1 · TkAUNG096510 · TK1151

Mitochondrion0.190

Rank 2 · TkAUNG096510 · TK1151

Nucleus0.173

Rank 3 · TkAUNG096510 · TK1151

Cell membrane0.164

Rank 4 · TkAUNG096510 · TK1151

Endoplasmic reticulum0.140

Rank 5 · TkAUNG096510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00781DAGK_cat15-113 aa

PF01513NAD_kinase22-51 aa

PF19279YegS_C134-286 aa

PF00609DAGK_acc149-267 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG096510	`PF00781`	DAGK_cat	15	113	2.3e-23	82.9
TkAUNG096510	`PF01513`	NAD_kinase	22	51	0.0036	18.3
TkAUNG096510	`PF19279`	YegS_C	134	286	2.1e-24	86.7
TkAUNG096510	`PF00609`	DAGK_acc	149	267	0.08	14.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82359`	Arabidopsis thaliana	sp\|O82359\|LCKB2_ARATH Sphingoid long-chain bases kinase 2, mitochondrial	76.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card