TkAUNG084080 | RubberDandelionOmics

Gene overview

TkAUNG084080

Reference: TK1151 Chr: ChrUn Coordinates: 23930793-23931188 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

396 bp · TkAUNG084080|TK1151|cDNA

ATGGTTTTACCTCCATCTTCAACGAAGAGGAATAGAATGATAATGGGTTCACAGGGTTACATCGATCCACAGTATCTGAAAACGGGATTAGTTTCGAAGAAGAACGATATATACAGCTACGGAATTGTTCTTCTGGAACTTGTTACAGGAAGGGAAGCGTTTTGTGTGGAGAGGAGGGAGATGTTGTCGGAGATTATTGGTCCGGTGGTGAGAGGGGTGGTGAGAGTGGCGGAGGTGATGGATCCACGGTTGCGAGGGTT...

CDS

Download CDS FASTA

396 bp · TkAUNG084080|TK1151|CDS

ATGGTTTTACCTCCATCTTCAACGAAGAGGAATAGAATGATAATGGGTTCACAGGGTTACATCGATCCACAGTATCTGAAAACGGGATTAGTTTCGAAGAAGAACGATATATACAGCTACGGAATTGTTCTTCTGGAACTTGTTACAGGAAGGGAAGCGTTTTGTGTGGAGAGGAGGGAGATGTTGTCGGAGATTATTGGTCCGGTGGTGAGAGGGGTGGTGAGAGTGGCGGAGGTGATGGATCCACGGTTGCGAGGGTT...

Protein

Download Protein FASTA

131 aa · TkAUNG084080|TK1151|PROTEIN

MVLPPSSTKRNRMIMGSQGYIDPQYLKTGLVSKKNDIYSYGIVLLELVTGREAFCVERREMLSEIIGPVVRGVVRVAEVMDPRLRGLADMKEVEAMVSMAVMCIGSSPMDRPCSNEIIASMRVSFESISHL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG084080`
TK1151 ID	TkAUNG084080
OH-1004 ID	LXL04_026078
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	37.800
Protein coverage (%)	TK1151 88.550 / OH-1004 28.401 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG084080

Location ChrUn:23930793-23931188 (+)

Description Similar to PBL15: Probable serine/threonine-protein kinase PBL15

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g10390`	Probable receptor-like protein kinase At4g10390.	No verified direct reference in this release
`At1g33260`	Probable receptor-like protein kinase At1g33260.	No verified direct reference in this release
`At1g61590`	May be involved in plant defense signaling.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0457800`	LRR receptor kinase involved in positive regulation of somatic embryogenesis and defense response against the rice blast fungus pathogen Magnaporthe oryzae.	Rice SERK1 gene positively regulates somatic embryogenesis of cultured cell and host defense response against fungal infection.2005 · DOI: 10.1007/s00425-005-1534-4 An XA21-associated kinase (OsSERK2) regulates immunity mediated by the XA21 and XA3 immune receptors.2014 · DOI: 10.1093/mp/ssu003

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026078 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002238 response to molecule of fungal origin Biological Process

GO:0006468 protein phosphorylation Biological Process

GO:0006952 defense response Biological Process

GO:0012501 programmed cell death Biological Process

GO:0032491 detection of molecule of fungal origin Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0062207 regulation of pattern recognition receptor signaling pathway Biological Process

GO:1901141 regulation of lignin biosynthetic process Biological Process

GO:1903428 positive regulation of reactive oxygen species biosynthetic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G61590

ath:AT2G05940

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.416

Rank 1 · TkAUNG084080 · TK1151

Cell membrane0.406

Rank 2 · TkAUNG084080 · TK1151

Nucleus0.301

Rank 3 · TkAUNG084080 · TK1151

Endoplasmic reticulum0.053

Rank 4 · TkAUNG084080 · TK1151

Golgi apparatus0.043

Rank 5 · TkAUNG084080 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase10-118 aa

PF07714PK_Tyr_Ser-Thr20-117 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG084080	`PF00069`	Pkinase	10	118	1.9e-07	31.5
TkAUNG084080	`PF07714`	PK_Tyr_Ser-Thr	20	117	0.0003	20.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SV83`	Arabidopsis thaliana	sp\|Q9SV83\|Y4103_ARATH Probable receptor-like protein kinase At4g10390	40.600%	Swiss-Prot	Medium
`P0DKI6`	Arabidopsis thaliana	sp\|P0DKI6\|Y1332_ARATH Probable receptor-like protein kinase At1g33260	36.500%	Swiss-Prot	Medium
`Q9SY91`	Arabidopsis thaliana	sp\|Q9SY91\|PBL15_ARATH Probable serine/threonine-protein kinase PBL15	37.500%	Swiss-Prot	Medium
`Q7XV05`	Oryza sativa subsp. japonica	sp\|Q7XV05\|SERK2_ORYSJ LRR receptor kinase SERK2	37.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card