TkAUNG072250 | RubberDandelionOmics

Gene overview

TkAUNG072250

Reference: TK1151 Chr: ChrUn Coordinates: 20886564-20891105 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1920 bp · TkAUNG072250|TK1151|cDNA

TTGCTCTAATCATTCTCTAACTTTATGATTAAACAAACCCCATTATCTTAATAGAAAACAATTAAAAACTCAATATCATTTGTTAATCCCAACTTTCTTTGACTTTTAATTCGTTTTCTGAAACATCCATTTGAAACCAATCCCAAAAATCCAATGGAAAATGGAGCAAGAAAACTGAGCGATGAATATGAAGTCACAACAATCTTGGGAAGAGGCGGGTTTTCGATTGTACGAAAAGGTATAAAGAAGTCAAAGGGCGA...

CDS

Download CDS FASTA

1545 bp · TkAUNG072250|TK1151|CDS

ATGGAAAATGGAGCAAGAAAACTGAGCGATGAATATGAAGTCACAACAATCTTGGGAAGAGGCGGGTTTTCGATTGTACGAAAAGGTATAAAGAAGTCAAAGGGCGAGTGTCCAGATGGTCAACAAGAAGTGGCAATCAAGACACTGAAAAGAGTCGGTGGTGGCGGCAGCGGCAGTAATGGGGTGGCCGGGTTTCCAAGCCGTAAGCAGGTTTTGATCTCGGACGCTTTGCTAGCAAACGAGATCATGGTAATGAAAAG...

Protein

Download Protein FASTA

514 aa · TkAUNG072250|TK1151|PROTEIN

MENGARKLSDEYEVTTILGRGGFSIVRKGIKKSKGECPDGQQEVAIKTLKRVGGGGSGSNGVAGFPSRKQVLISDALLANEIMVMKRVVDEVSPHCNVIQLHDVCEDPTGVHLVLELCSGGELFDRIVTQERYSEAEAAKVVQQIASGLAALHKANVIHRDLKPENCLFLDKSKESPLKIMDFGLSSVEEFTDPVVGLFGSIDYVSPEALAQRKITSKSDMWALGVILYILLSGYPPFSAQSHLQKQQMIMNGNFSFYDK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG072250`
TK1151 ID	TkAUNG072250
OH-1004 ID	LXL04_019509
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG072250

Location ChrUn:20886564-20891105 (+)

Description Similar to CCAMK: Calcium and calcium/calmodulin-dependent serine/threonine-protein kinase DMI-3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0489900`	Calcium- and calmodulin-dependent protein kinase required for arbuscular mycorrhizal (AM) symbiosis.	A rice calcium- and calmodulin-dependent protein kinase restores nodulation to a legume mutant.2006 · DOI: 10.1094/mpmi-19-0495 Fungal symbiosis in rice requires an ortholog of a legume common symbiosis gene encoding a Ca2+/calmodulin-dependent protein kinase.2007 · DOI: 10.1104/pp.107.109876 Divergence of evolutionary ways among common sym genes: CASTOR and CCaMK show functional conservation between two symbiosis systems and constitute the root of a common signaling pathway.2008 · DOI: 10.1093/pcp/pcn153 OsDMI3 is a novel component of abscisic acid signaling in the induction of antioxidant defense in leaves of rice.2012 · DOI: 10.1093/mp/sss068 OsDMI3-mediated activation of OsMPK1 regulates the activities of antioxidant enzymes in abscisic acid signalling in rice.2014 · DOI: 10.1111/pce.12154

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019509 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009608 response to symbiont Biological Process

GO:0009877 nodulation Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0004683 calcium/calmodulin-dependent protein kinase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

GO:0005516 calmodulin binding Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0009931 calcium-dependent protein serine/threonine kinase activity Molecular Function

KEGG gene cross-reference

dosa:Os05g0489900

mtr:11405240

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.521

Rank 1 · TkAUNG072250 · TK1151

Nucleus0.316

Rank 2 · TkAUNG072250 · TK1151

Cell membrane0.233

Rank 3 · TkAUNG072250 · TK1151

Golgi apparatus0.082

Rank 4 · TkAUNG072250 · TK1151

Endoplasmic reticulum0.063

Rank 5 · TkAUNG072250 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase12-296 aa

PF07714PK_Tyr_Ser-Thr14-292 aa

PF01636APH79-159 aa

PF06293Kdo128-183 aa

PF14531Kinase-like144-284 aa

PF01636APH145-174 aa

PF20390DUF6685342-390 aa

PF13499EF-hand_7352-384 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG072250	`PF00069`	Pkinase	12	296	9.8e-65	219.3
TkAUNG072250	`PF07714`	PK_Tyr_Ser-Thr	14	292	7.4e-35	121.2
TkAUNG072250	`PF01636`	APH	79	159	0.19	12.2
TkAUNG072250	`PF06293`	Kdo	128	183	0.00087	19.5
TkAUNG072250	`PF14531`	Kinase-like	144	284	0.065	13.2
TkAUNG072250	`PF01636`	APH	145	174	0.19	12.2
TkAUNG072250	`PF20390`	DUF6685	342	390	0.053	13.9
TkAUNG072250	`PF13499`	EF-hand_7	352	384	1e-17	64.9
TkAUNG072250	`PF12763`	EH	354	416	1.2e-05	25.8
TkAUNG072250	`PF13405`	EF-hand_6	360	386	4.1e-20	70.2
TkAUNG072250	`PF24548`	EF_EFCAB10_C	369	381	0.029	14.7
TkAUNG072250	`PF25432`	FF_PRPF40A	373	387	0.027	15.0
TkAUNG072250	`PF00036`	EF-hand_1	376	386	2.1e-19	68.2
TkAUNG072250	`PF13202`	EF-hand_5	376	383	1e-13	50.7
TkAUNG072250	`PF30624`	EF_SSP120	396	414	0.00017	22.9
TkAUNG072250	`PF23564`	EF-hand_FSTL1	396	416	0.00019	22.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6AVM3`	Oryza sativa subsp. japonica	sp\|Q6AVM3\|CCAMK_ORYSJ Calcium and calcium/calmodulin-dependent serine/threonine-protein kinase	69.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card