TkAUNG066820 | RubberDandelionOmics

Gene overview

TkAUNG066820

Reference: TK1151 Chr: ChrUn Coordinates: 19395719-19396749 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

911 bp · TkAUNG066820|TK1151|cDNA

CAAGTGTCCACATGGGAAACATGGCTTTATGCACACAACTCCCTCCACCGGAGCAAAACACAAAATGGAGCTCAAAGACGCCATTGCACCCTTCGTAATGAAGACTTACCAAATGGTAAACGATCCGTCATCGGATAATCTCATCCGGTGGGGTTACGCCGGCAACAGCTTCATCGTCATGGACTCATTACGCTTCTCGCAATGCCTCTTGCCTGCATTCTTCAAGCACAGCAATTTCTCCAGTTTCATTCGCCAATTAA...

CDS

Download CDS FASTA

810 bp · TkAUNG066820|TK1151|CDS

ATGCACACAACTCCCTCCACCGGAGCAAAACACAAAATGGAGCTCAAAGACGCCATTGCACCCTTCGTAATGAAGACTTACCAAATGGTAAACGATCCGTCATCGGATAATCTCATCCGGTGGGGTTACGCCGGCAACAGCTTCATCGTCATGGACTCATTACGCTTCTCGCAATGCCTCTTGCCTGCATTCTTCAAGCACAGCAATTTCTCCAGTTTCATTCGCCAATTAAACACTTACGGGTTCAGAAAAGTGGATCC...

Protein

Download Protein FASTA

269 aa · TkAUNG066820|TK1151|PROTEIN

MHTTPSTGAKHKMELKDAIAPFVMKTYQMVNDPSSDNLIRWGYAGNSFIVMDSLRFSQCLLPAFFKHSNFSSFIRQLNTYGFRKVDPDRCEFANEWFLRGQVHLLKNIGRKRQSKSSGNLTVNFRGEDDEEDEMAVEIARLKEEQKALEKEMVAMRKRLEATERRPKQIMALLCQVAKDPQILPRMMREMEQKRLMEMKRQRTSPASSSGIANWVKCEEWRSSTLTETPSTNNAGGGGSSFDTDNGSGLVGSDARRPPPY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG066820`
TK1151 ID	TkAUNG066820
OH-1004 ID	LXL04_002536
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	73.500
Protein coverage (%)	TK1151 67.286 / OH-1004 57.282 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG066820

Location ChrUn:19395719-19396749 (-)

Description Similar to HSFC1: Heat stress transcription factor C-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g24520`	Transcriptional regulator that specifically binds DNA sequence 5'-AGAAnnTTCT-3' known as heat shock promoter elements (HSE).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0232000`	Transcriptional regulator that specifically binds DNA of heat shock promoter elements (HSE).	No verified direct reference in this release
`Os01g0625300`	Transcriptional regulator that specifically binds DNA of heat shock promoter elements (HSE).	No verified direct reference in this release
`Os06g0553100`	Transcriptional regulator that specifically binds DNA of heat shock promoter elements (HSE).	No verified direct reference in this release
`Os07g0178600`	Transcriptional regulator that specifically binds DNA of heat shock promoter elements (HSE).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002536 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0034605 cellular response to heat Biological Process

GO:0005634 nucleus Cellular Component

GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT3G24520

dosa:Os01g0625300

dosa:Os01g0733200

dosa:Os02g0232000

dosa:Os06g0553100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.967

Rank 1 · TkAUNG066820 · TK1151

Cytoplasm0.099

Rank 2 · TkAUNG066820 · TK1151

Cell membrane0.020

Rank 3 · TkAUNG066820 · TK1151

Endoplasmic reticulum0.010

Rank 4 · TkAUNG066820 · TK1151

Mitochondrion0.010

Rank 5 · TkAUNG066820 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00447HSF_DNA-bind22-111 aa

PF03961FapA106-195 aa

PF17253DUF5320109-161 aa

PF05524PEP-utilisers_N126-194 aa

PF10211Ax_dynein_light128-171 aa

PF29363ENTR1130-200 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG066820	`PF00447`	HSF_DNA-bind	22	111	1.9e-27	96.4
TkAUNG066820	`PF03961`	FapA	106	195	0.57	10.5
TkAUNG066820	`PF17253`	DUF5320	109	161	0.092	14.6
TkAUNG066820	`PF05524`	PEP-utilisers_N	126	194	0.021	15.7
TkAUNG066820	`PF10211`	Ax_dynein_light	128	171	0.087	13.6
TkAUNG066820	`PF29363`	ENTR1	130	200	0.19	12.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LV52`	Arabidopsis thaliana	sp\|Q9LV52\|HSFC1_ARATH Heat stress transcription factor C-1	63.000%	Swiss-Prot	Medium
`Q6EUG4`	Oryza sativa subsp. japonica	sp\|Q6EUG4\|HFC2A_ORYSJ Heat stress transcription factor C-2a	51.400%	Swiss-Prot	Medium
`Q6VBA4`	Oryza sativa subsp. japonica	sp\|Q6VBA4\|HFC1A_ORYSJ Heat stress transcription factor C-1a	49.200%	Swiss-Prot	Medium
`Q0DBL6`	Oryza sativa subsp. japonica	sp\|Q0DBL6\|HFC2B_ORYSJ Heat stress transcription factor C-2b	48.600%	Swiss-Prot	Medium
`Q6VBB2`	Oryza sativa subsp. japonica	sp\|Q6VBB2\|HFA2B_ORYSJ Heat stress transcription factor A-2b	46.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card