TkAUNG048890 | RubberDandelionOmics

Gene overview

TkAUNG048890

Reference: TK1151 Chr: ChrUn Coordinates: 13536533-13537994 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

855 bp · TkAUNG048890|TK1151|cDNA

ATGTCGTATGCTAACATATCTGACCTTAATCCATCAAGAGAGGATTGGCTTATCCAAGCACGGTTGTGTAGGATGTGGGAAGCAATCAATTTTAAGAATGACAACGACATTATGGGCTTAGAGATGGTATTTGTTGATGATAAGGGTGATTCAATTCAGGCTTACATTAGGAAGAACCATATGAAGAGATACAAGCCTATGTTGGAAGAAAGTGAGGTCTATGCTATTAGAAATTTCAGAGTCGCCAAATCAGCTGTTCA...

CDS

Download CDS FASTA

855 bp · TkAUNG048890|TK1151|CDS

ATGTCGTATGCTAACATATCTGACCTTAATCCATCAAGAGAGGATTGGCTTATCCAAGCACGGTTGTGTAGGATGTGGGAAGCAATCAATTTTAAGAATGACAACGACATTATGGGCTTAGAGATGGTATTTGTTGATGATAAGGGTGATTCAATTCAGGCTTACATTAGGAAGAACCATATGAAGAGATACAAGCCTATGTTGGAAGAAAGTGAGGTCTATGCTATTAGAAATTTCAGAGTCGCCAAATCAGCTGTTCA...

Protein

Download Protein FASTA

284 aa · TkAUNG048890|TK1151|PROTEIN

MSYANISDLNPSREDWLIQARLCRMWEAINFKNDNDIMGLEMVFVDDKGDSIQAYIRKNHMKRYKPMLEESEVYAIRNFRVAKSAVQYKTHEERVYNNTLLTGYEKKIELKTETEKIMTVTLWGNISGMFDYSPYKGDDTPVIAIITSTTIKSFQRQLGYASTTATRIYFNLDIHEVKSLRTRFAEGNEGIKLLESEHIVHVPLAEQMSLNRRTIGQILDMEWISDNQERVFTVLAKIVEIEERYGWCYVSCNQCIKKVV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG048890`
TK1151 ID	TkAUNG048890
OH-1004 ID	LXL04_035390
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	74.400
Protein coverage (%)	TK1151 94.366 / OH-1004 50.072 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG048890`
Location	ChrUn:13536533-13537994 (+)
Description	Similar to RPA1B: Replication protein A 70 kDa DNA-binding subunit B
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_035390` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000723 telomere maintenance Biological Process GO:0000724 double-strand break repair via homologous recombination Biological Process GO:0006260 DNA replication Biological Process GO:0006281 DNA repair Biological Process GO:0006289 nucleotide-excision repair Biological Process GO:0006312 mitotic recombination Biological Process GO:0007004 telomere maintenance via telomerase Biological Process GO:0007131 reciprocal meiotic recombination Biological Process GO:0007141 male meiosis I Biological Process GO:0009555 pollen development Biological Process GO:0010224 response to UV-B Biological Process GO:0033260 nuclear DNA replication Biological Process
KEGG gene cross-reference	ath:AT2G06510 ath:AT5G08020 ath:AT5G61000 spo:2541158 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.949

Rank 1 · TkAUNG048890 · TK1151

Cytoplasm0.116

Rank 2 · TkAUNG048890 · TK1151

Cell membrane0.019

Rank 3 · TkAUNG048890 · TK1151

Mitochondrion0.015

Rank 4 · TkAUNG048890 · TK1151

Extracellular0.012

Rank 5 · TkAUNG048890 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02721DUF2237-92 aa

PF16900REPA_OB_228-82 aa

PF16900REPA_OB_2105-157 aa

PF19133DUF5816229-272 aa

PF08646Rep_fac-A_C232-283 aa

PF27511ComFA_N236-277 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG048890	`PF02721`	DUF223	7	92	1.4e-14	55.0
TkAUNG048890	`PF16900`	REPA_OB_2	28	82	0.00028	21.5
TkAUNG048890	`PF16900`	REPA_OB_2	105	157	0.00028	21.5
TkAUNG048890	`PF19133`	DUF5816	229	272	0.22	12.5
TkAUNG048890	`PF08646`	Rep_fac-A_C	232	283	4.2e-06	27.3
TkAUNG048890	`PF27511`	ComFA_N	236	277	0.054	14.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card