TkAUNG031720 | RubberDandelionOmics

Gene overview

TkAUNG031720

Reference: TK1151 Chr: ChrUn Coordinates: 8516201-8518411 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1518 bp · TkAUNG031720|TK1151|cDNA

GTCCAGAACCTTCTCTTCCTTTCCAGACGGTTCCACGTGTGTGGTAGTAAATTTTTTCTCGTGAAGTCTCAAGGCGTCTTTTTTACGCATATAGAGATCAAGCGTGATAAATTATTAGCGCCCTGTTCATCTATTCAACAATTCTGTCTCCTAGACTCCTTCTAGCTTACTGTTGATCTTTTGTTCGTTGCGAAATTGTTGAGGTAAAGTTACCTGATTTCTCCAAAATGTTTTAATTATGATTTATCTATTTGTCCGTG...

CDS

Download CDS FASTA

906 bp · TkAUNG031720|TK1151|CDS

ATGTCGTACTCGAGGAGGTCAAGGTACTCCCCTTCTCCTTCACCACCACACAAGCGCTACGGCAGGTCTCTCTCACGTTCCAGATCCAGATCAAGCTCAAGGAGTCGGAGCTATGATCCAAGCGACATTGAAAACCCTGGAAACAATTTATACGTAACTGGTTTATCACCACGTATCACAAAAAGAGATCTCGAGAAGCATTTCTCCACAGAGGGAAATGTGGAAGACGTCCACCTAGTGATAGATCCACGGACTCGAGA...

Protein

Download Protein FASTA

301 aa · TkAUNG031720|TK1151|PROTEIN

MSYSRRSRYSPSPSPPHKRYGRSLSRSRSRSSSRSRSYDPSDIENPGNNLYVTGLSPRITKRDLEKHFSTEGNVEDVHLVIDPRTRESRGFGFVSMSNIKEADRCIKYLDGSVLEGRVITVEKARRRRGRTPTPGRYLGLRSSGRGRSPTYSPYSRSRSRSRSYSPYYHSRGGRSYSSYRRRRSYSPYSRSPVDRRRSYTPDYYYYRRSHSRYSREDSYSRKRGGDYYYRRDYSYSPKYRRGRSRRRSVSVSSSGRSYES...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG031720`
TK1151 ID	TkAUNG031720
OH-1004 ID	LXL04_013843
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	58.800
Protein coverage (%)	TK1151 33.887 / OH-1004 40.157 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG031720

Location ChrUn:8516201-8518411 (+)

Description Similar to SR45A: Serine/arginine-rich splicing factor SR45a

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g07350`	Probable splicing factor involved in constitutive and/or alternative splicing events.	No verified direct reference in this release
`At5g04280`	Binds RNA and DNA sequences non-specifically.	No verified direct reference in this release
`At4g24770`	Required for specific RNA editing events in chloroplasts and stabilizes specific chloroplast mRNAs.	Arabidopsis chloroplast RNA binding proteins CP31A and CP29A associate with large transcript pools and confer cold stress tolerance by influencing multiple chloroplast RNA processing steps.2012 · DOI: 10.1105/tpc.112.103002

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013843 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000302 response to reactive oxygen species Biological Process

GO:0000375 RNA splicing, via transesterification reactions Biological Process

GO:0000381 regulation of alternative mRNA splicing, via spliceosome Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009644 response to high light intensity Biological Process

GO:0043484 regulation of RNA splicing Biological Process

GO:0045292 mRNA cis splicing, via spliceosome Biological Process

GO:0048026 positive regulation of mRNA splicing, via spliceosome Biological Process

GO:0071333 cellular response to glucose stimulus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005637 nuclear inner membrane Cellular Component

KEGG gene cross-reference

ath:AT1G07350

hsa:6434

mmu:20462

rno:117259

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.965

Rank 1 · TkAUNG031720 · TK1151

Cytoplasm0.163

Rank 2 · TkAUNG031720 · TK1151

Cell membrane0.016

Rank 3 · TkAUNG031720 · TK1151

Endoplasmic reticulum0.009

Rank 4 · TkAUNG031720 · TK1151

Mitochondrion0.009

Rank 5 · TkAUNG031720 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076RRM_150-120 aa

PF13893RRM_550-123 aa

PF16842RRM_occluded50-121 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG031720	`PF00076`	RRM_1	50	120	6.4e-17	61.9
TkAUNG031720	`PF13893`	RRM_5	50	123	0.02	15.3
TkAUNG031720	`PF16842`	RRM_occluded	50	121	0.35	11.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84TH4`	Arabidopsis thaliana	sp\|Q84TH4\|SR45A_ARATH Serine/arginine-rich splicing factor SR45a	65.600%	Swiss-Prot	Medium
`Q8RWN5`	Arabidopsis thaliana	sp\|Q8RWN5\|RZ1C_ARATH Glycine-rich RNA-binding protein RZ1C	38.100%	Swiss-Prot	Low
`Q04836`	Arabidopsis thaliana	sp\|Q04836\|CP31A_ARATH 31 kDa ribonucleoprotein, chloroplastic	41.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card