TkAUNG030510 | RubberDandelionOmics

Gene overview

TkAUNG030510

Reference: TK1151 Chr: ChrUn Coordinates: 8200664-8206433 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2802 bp · TkAUNG030510|TK1151|cDNA

ATGGCTAAACGCCGTCTTGAACGTGAAAAAGGACGCAGAGAAGCAATTGCTGATATGTCTGAGGATTTATCTGAGGGGGAGAAAGGAGATGTAGTTGGTGACATTTCATCCCAGACTGAAAGCAATAGGGGTCGCTTGCCTAGAATTAGTTCGGTTGATACTATGGAGGCCTGGGCTAGTCAACAAAAGGGCAAAAAGCTGTATATTGTATTGATTAGCCTTCATGGATTAATACGTGGTGAAAACATGGAGCTTGGCCG...

CDS

Download CDS FASTA

2802 bp · TkAUNG030510|TK1151|CDS

ATGGCTAAACGCCGTCTTGAACGTGAAAAAGGACGCAGAGAAGCAATTGCTGATATGTCTGAGGATTTATCTGAGGGGGAGAAAGGAGATGTAGTTGGTGACATTTCATCCCAGACTGAAAGCAATAGGGGTCGCTTGCCTAGAATTAGTTCGGTTGATACTATGGAGGCCTGGGCTAGTCAACAAAAGGGCAAAAAGCTGTATATTGTATTGATTAGCCTTCATGGATTAATACGTGGTGAAAACATGGAGCTTGGCCG...

Protein

Download Protein FASTA

933 aa · TkAUNG030510|TK1151|PROTEIN

MAKRRLEREKGRREAIADMSEDLSEGEKGDVVGDISSQTESNRGRLPRISSVDTMEAWASQQKGKKLYIVLISLHGLIRGENMELGRDSDTGGQGEVVVELARALGSMPGVYRVDLLTRQVSSPEVDWSYGEPTEMLPPRDSEGLMNEMGESSGAYIVRVPFGPKDKYIPKEQLWPHIPEFVDGALNHIIQMSKVLGEQIGNGHLVWPVAIHGHYADAGDSAALLSGALNVPMLFTGHSLGRDKLEQLLRQSRLSKDEIN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG030510`
TK1151 ID	TkAUNG030510
OH-1004 ID	LXL04_028085
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	77.200
Protein coverage (%)	TK1151 100.000 / OH-1004 88.374 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG030510

Location ChrUn:8200664-8206433 (+)

Description Similar to SPS1: Probable sucrose-phosphate synthase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g20280`	Plays a major role in photosynthetic sucrose synthesis by catalyzing the rate-limiting step of sucrose biosynthesis from UDP- glucose and fructose- 6-phosphate.	Decrease in leaf sucrose synthesis leads to increased leaf starch turnover and decreased RuBP regeneration-limited photosynthesis but not Rubisco-limited photosynthesis in Arabidopsis null mutants of SPSA1.2011 · DOI: 10.1111/j.1365-3040.2010.02265.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028085 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005986 sucrose biosynthetic process Biological Process

GO:0071836 nectar secretion Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0046524 sucrose-phosphate synthase activity Molecular Function

KEGG gene cross-reference

ath:AT5G20280

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.320

Rank 1 · TkAUNG030510 · TK1151

Nucleus0.287

Rank 2 · TkAUNG030510 · TK1151

Cell membrane0.167

Rank 3 · TkAUNG030510 · TK1151

Plastid0.124

Rank 4 · TkAUNG030510 · TK1151

Golgi apparatus0.095

Rank 5 · TkAUNG030510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00862GT-B_Sucrose_synth68-335 aa

PF13579Glyco_trans_4_492-289 aa

PF13439Glyco_transf_492-250 aa

PF00534Glycos_transf_1371-544 aa

PF13692Glyco_trans_1_4376-533 aa

PF20706GT4-conflict466-538 aa

PF13439Glyco_transf_4479-500 aa

PF05116S6PP653-879 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG030510	`PF00862`	GT-B_Sucrose_synth	68	335	1.7e-09	37.7
TkAUNG030510	`PF13579`	Glyco_trans_4_4	92	289	0.00025	22.1
TkAUNG030510	`PF13439`	Glyco_transf_4	92	250	0.00044	21.0
TkAUNG030510	`PF00534`	Glycos_transf_1	371	544	2.2e-22	80.1
TkAUNG030510	`PF13692`	Glyco_trans_1_4	376	533	1.6e-15	58.4
TkAUNG030510	`PF20706`	GT4-conflict	466	538	0.0025	17.6
TkAUNG030510	`PF13439`	Glyco_transf_4	479	500	0.00044	21.0
TkAUNG030510	`PF05116`	S6PP	653	879	3.8e-13	50.3
TkAUNG030510	`PF13439`	Glyco_transf_4	704	764	0.00044	21.0
TkAUNG030510	`PF13579`	Glyco_trans_4_4	812	844	0.00025	22.1
TkAUNG030510	`PF13439`	Glyco_transf_4	827	882	0.00044	21.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94BT0`	Arabidopsis thaliana	sp\|Q94BT0\|SPSA1_ARATH Sucrose-phosphate synthase 1	75.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card