RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkAUNG015590
Reference: TK1151 Chr: ChrUn Coordinates: 4144877-4147457 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2500 bp · TkAUNG015590|TK1151|cDNA

AATCATTGTTTTCCTCTAACACTACTATCACCATGCAATCACCCGACATTAATTTTTTACCACCCAAAATTCTCACCAACTTTCCAAATCGGAGAAACCGTTATTCACTCACATGTCCATTGTTAGTCGCCGCCGTTACCACTGCCTCCTCCTCCTCCTTTCCATTTTCCAAATTTTCCCTCCATGTCTCTCCTTTCGTCACTCCCCCGCTGTTTCCCTCCTCCAGTTCAAAGAATCATTTTCCAAATCCGATTCTTTAT...

CDS

Download CDS FASTA

2076 bp · TkAUNG015590|TK1151|CDS

ATGTCCATTGTTAGTCGCCGCCGTTACCACTGCCTCCTCCTCCTCCTTTCCATTTTCCAAATTTTCCCTCCATGTCTCTCCTTTCGTCACTCCCCCGCTGTTTCCCTCCTCCAGTTCAAAGAATCATTTTCCAAATCCGATTCTTTATCCAATTGGAAAGACGATGGATCCCACCCCTGCGACCCCAATAATGTGTGGATCGGAATCATATGTTCCGATGGCCTAATTAACACCATCAACCTCGCCGGCATGGATCTCCG...

Protein

Download Protein FASTA

691 aa · TkAUNG015590|TK1151|PROTEIN

MSIVSRRRYHCLLLLLSIFQIFPPCLSFRHSPAVSLLQFKESFSKSDSLSNWKDDGSHPCDPNNVWIGIICSDGLINTINLAGMDLRGQPDISTLESIDGLVTISLDGNSLVGPMPEINRLPSLKAFYAGGNLFSGVIPSDFFQTLGSLKKLWLQNNHFSGQIPISVGQLPNLKELHLEYNQFSGPIPEFSDPDVLINIDLSDNRLQGEIPKSLQKFDSQAFDNNADLCGGPLKECTPTQREEEDSTYRKSAIPWIILIV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkAUNG015590
TK1151 IDTkAUNG015590
OH-1004 IDLXL04_002303
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)97.800
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkAUNG015590
LocationChrUn:4144877-4147457 (-)
DescriptionSimilar to PRK6: Pollen receptor-like kinase 6
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g42880 Receptor-like kinase involved in the control of pollen germination and pollen tube polar growth. No verified direct reference in this release
At5g20690 Key receptor for sensing species-specific attractants in cooperation with other pollen receptor-like kinases.
Tip-localized receptors control pollen tube growth and LURE sensing in Arabidopsis.2016 · DOI: 10.1038/nature17413
Structural basis for receptor recognition of pollen tube attraction peptides.2017 · DOI: 10.1038/s41467-017-01323-8
At5g35390 Receptor-like kinase involved in the control of pollen germination and pollen tube polar growth.
AtPRK2 promotes ROP1 activation via RopGEFs in the control of polarized pollen tube growth.2013 · DOI: 10.1093/mp/sss103
At4g31250 Probable LRR receptor-like serine/threonine-protein kinase At4g31250. No verified direct reference in this release
At3g20190 Receptor-like kinase involved in the control of pollen germination and pollen tube polar growth. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_002303 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0010183 pollen tube guidance Biological Process
GO:0080092 regulation of pollen tube growth Biological Process
GO:0005576 extracellular region Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009506 plasmodesma Cellular Component
GO:0016324 apical plasma membrane Cellular Component
GO:0045177 apical part of cell Cellular Component
GO:0090404 pollen tube tip Cellular Component
GO:0004674 protein serine/threonine kinase activity Molecular Function
GO:0005524 ATP binding Molecular Function
GO:0042802 identical protein binding Molecular Function
KEGG gene cross-reference
ath:AT3G42880
ath:AT4G31250
ath:AT5G20690
ath:AT5G35390
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.882
Rank 1 · TkAUNG015590 · TK1151
Cytoplasm0.075
Rank 2 · TkAUNG015590 · TK1151
Endoplasmic reticulum0.074
Rank 3 · TkAUNG015590 · TK1151
Nucleus0.053
Rank 4 · TkAUNG015590 · TK1151
Golgi apparatus0.019
Rank 5 · TkAUNG015590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263LRRNT_235-72 aa
PF12799LRR_492-112 aa
PF25019LRR_R13L1-DRL2194-126 aa
PF13855LRR_899-132 aa
PF00560LRR_1101-117 aa
PF25019LRR_R13L1-DRL21122-179 aa
PF00560LRR_1123-143 aa
PF13855LRR_8137-183 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkAUNG015590PF08263LRRNT_235722.5e-0628.3
TkAUNG015590PF12799LRR_4921126.7e-0833.3
TkAUNG015590PF25019LRR_R13L1-DRL21941260.04614.4
TkAUNG015590PF13855LRR_8991325.4e-0730.0
TkAUNG015590PF00560LRR_11011173.3e-1347.7
TkAUNG015590PF25019LRR_R13L1-DRL211221790.04614.4
TkAUNG015590PF00560LRR_11231433.3e-1347.7
TkAUNG015590PF13855LRR_81371835.4e-0730.0
TkAUNG015590PF00560LRR_11481703.3e-1347.7
TkAUNG015590PF12799LRR_41481856.7e-0833.3
TkAUNG015590PF07723LRR_21481610.06314.7
TkAUNG015590PF26019HTH_TIMELESS1711990.0116.8
TkAUNG015590PF00560LRR_11721893.3e-1347.7
TkAUNG015590PF07723LRR_21721850.06314.7
TkAUNG015590PF13855LRR_81902165.4e-0730.0
TkAUNG015590PF00560LRR_11962163.3e-1347.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9M1L7Arabidopsis thalianasp|Q9M1L7|PRK3_ARATH Pollen receptor-like kinase 342.500%Swiss-ProtMedium
Q3E991Arabidopsis thalianasp|Q3E991|PRK6_ARATH Pollen receptor-like kinase 665.200%Swiss-ProtLow
C0LGU0Arabidopsis thalianasp|C0LGU0|PRK1_ARATH Pollen receptor-like kinase 134.200%Swiss-ProtMedium
C0LGR9Arabidopsis thalianasp|C0LGR9|Y4312_ARATH Probable LRR receptor-like serine/threonine-protein kinase At4g3125035.600%Swiss-ProtMedium
Q9LJY0Arabidopsis thalianasp|Q9LJY0|PRK4_ARATH Pollen receptor-like kinase 430.200%Swiss-ProtMedium

JBrowse

View in Genome Browser