TkAUNG009970 | RubberDandelionOmics

Gene overview

TkAUNG009970

Reference: TK1151 Chr: ChrUn Coordinates: 2472984-2474507 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1494 bp · TkAUNG009970|TK1151|cDNA

ATGGAACTCTCTCCCAGAGCTGCAGAACTAACGACTCTATTAGAAAGTCGAATTAGCAACTTTTACACAAATTTTCAAGTGGATGAGATCGGTCGAGTGGTCTCAGTTGGAGATGGTATTGCACGTGTTTATGGATTGAACGAGATTCAAGCTGGGGAAATGGTTGAATTTTCCAGCGGTGTGAAAGGAATAGCCTTAAATCTTGAGAATGAGAATGTAGGGATTGTTGTCTTTGGTAGTGATACTGCTATTAAAGAAGG...

CDS

Download CDS FASTA

1494 bp · TkAUNG009970|TK1151|CDS

ATGGAACTCTCTCCCAGAGCTGCAGAACTAACGACTCTATTAGAAAGTCGAATTAGCAACTTTTACACAAATTTTCAAGTGGATGAGATCGGTCGAGTGGTCTCAGTTGGAGATGGTATTGCACGTGTTTATGGATTGAACGAGATTCAAGCTGGGGAAATGGTTGAATTTTCCAGCGGTGTGAAAGGAATAGCCTTAAATCTTGAGAATGAGAATGTAGGGATTGTTGTCTTTGGTAGTGATACTGCTATTAAAGAAGG...

Protein

Download Protein FASTA

497 aa · TkAUNG009970|TK1151|PROTEIN

MELSPRAAELTTLLESRISNFYTNFQVDEIGRVVSVGDGIARVYGLNEIQAGEMVEFSSGVKGIALNLENENVGIVVFGSDTAIKEGDLVKRTGSIVDVPAGKAMLGRVVDALGVPIDGRGALSAHERRRVEVKAPGIIERKSVHEPMQTGLKAVDSLVPIGRGQRELIIGDRQTVNQKQLNSKATSESETLYCVYVAIGQKRSTVAQLVQILSEANALEYSILVAATASDPAPLQFLAPYSGCAMGEYFRDNGMHALII...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG009970`
TK1151 ID	TkAUNG009970
OH-1004 ID	LXL04_040167
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	65.200
Protein coverage (%)	TK1151 22.535 / OH-1004 15.079 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG009970

Location ChrUn:2472984-2474507 (+)

Description Similar to COX2: Cytochrome c oxidase subunit 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: P0C520`	Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_040167 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0015986 proton motive force-driven ATP synthesis Biological Process

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0031966 mitochondrial membrane Cellular Component

GO:0045259 proton-transporting ATP synthase complex Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0043531 ADP binding Molecular Function

GO:0046933 proton-transporting ATP synthase activity, rotational mechanism Molecular Function

GO:0051087 protein-folding chaperone binding Molecular Function

KEGG gene cross-reference

han:18250974

rsz:13630159

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.412

Rank 1 · TkAUNG009970 · TK1151

Plastid0.159

Rank 2 · TkAUNG009970 · TK1151

Nucleus0.155

Rank 3 · TkAUNG009970 · TK1151

Mitochondrion0.130

Rank 4 · TkAUNG009970 · TK1151

Cell membrane0.077

Rank 5 · TkAUNG009970 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02874ATP-synt_ab_N27-94 aa

PF09378HAS-barrel29-76 aa

PF09378HAS-barrel75-114 aa

PF02874ATP-synt_ab_N132-146 aa

PF00006ATP-synt_ab151-365 aa

PF00306ATP-synt_ab_C372-491 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG009970	`PF02874`	ATP-synt_ab_N	27	94	9.9e-21	74.7
TkAUNG009970	`PF09378`	HAS-barrel	29	76	0.0038	18.0
TkAUNG009970	`PF09378`	HAS-barrel	75	114	0.0038	18.0
TkAUNG009970	`PF02874`	ATP-synt_ab_N	132	146	9.9e-21	74.7
TkAUNG009970	`PF00006`	ATP-synt_ab	151	365	1.3e-75	254.5
TkAUNG009970	`PF00306`	ATP-synt_ab_C	372	491	1.4e-42	145.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P0C520`	Oryza sativa	sp\|P0C520\|ATPAM_ORYSA ATP synthase subunit alpha, mitochondrial	91.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card