RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA08G429520
Reference: TK1151 Chr: Chr08 Coordinates: 109137865-109142448 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2001 bp · TkA08G429520|TK1151|cDNA

AAACATATAAGTGAAAAGGGTATTGGAAGGGGTAACTGAACAAAGAAAAAATGAAAATTTTAAGAACAATGGTGTTCTTGTAATTTTTTAGGACAAGCATGTCCATTTATTCATTTTTCTCCTTTAAAGATAGAGCATTTATAATGAGAGTTTAATGAGAGAGTTAAATGAGATGACAAGTCTCAGTGTCACTCAATGCATATAACTCTACCATGTTGAGATGCCATATTGACATTCAATGGATTTGGAGTTCAATGATC...

CDS

Download CDS FASTA

1008 bp · TkA08G429520|TK1151|CDS

ATGGATAGTTCAACCCTAGAATCTCAGGTCAGATCCGACAACTTCGTCACGTACGAATCCCCTTGCACACTCTACTCCATGGCCATCTCCTCCGCCGCAGCCTCACGCCGCAGAATCGCCCTCGGCAGCTTCATCGAAGAATACGCCAATCGAGTCGACATAGTCACATTCGATGAAGAAACTCTTTCCATCAAACCAATCCCTAAGCTCTCATTCGACCACCCCTATCCTCCTACTAAACTTATGTTCCACCCTAACCC...

Protein

Download Protein FASTA

335 aa · TkA08G429520|TK1151|PROTEIN

MDSSTLESQVRSDNFVTYESPCTLYSMAISSAAASRRRIALGSFIEEYANRVDIVTFDEETLSIKPIPKLSFDHPYPPTKLMFHPNPKLSGDILASSGDFLRLYGVRDNSIEPISVLNNSKSSEFCAPLTSFDWNEVEPRRIGTSSIDTTCTIWDVERGVVETQLIAHDKEVHDIAWGEAGVFASVSADGSVRVFDLRDKEHSTIIYESPQPDTPLLRLAWNKQDLRYMATILMDSNKIVILDIRSPTMPVAELERHRGS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA08G429520
TK1151 IDTkA08G429520
OH-1004 IDLXL04_034722
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA08G429520
LocationChr08:109137865-109142448 (-)
DescriptionSimilar to TTG1: Protein TRANSPARENT TESTA GLABRA 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g24520 May regulate MYC transcription factors.
GL3 encodes a bHLH protein that regulates trichome development in arabidopsis through interaction with GL1 and TTG1.2000 · DOI: 10.1093/genetics/156.3.1349
At1g12910 Clock protein essential for the proper expression phase and period length of both the oscillator and output genes known to participate in photoperiod sensing.
Two new clock proteins, LWD1 and LWD2, regulate Arabidopsis photoperiodic flowering.2008 · DOI: 10.1104/pp.108.124917
LIGHT-REGULATED WD1 and PSEUDO-RESPONSE REGULATOR9 form a positive feedback regulatory loop in the Arabidopsis circadian clock.2011 · DOI: 10.1105/tpc.110.081661
At3g26640 Clock protein essential for the proper expression phase and period length of both the oscillator and output genes known to participate in photoperiod sensing.
Two new clock proteins, LWD1 and LWD2, regulate Arabidopsis photoperiodic flowering.2008 · DOI: 10.1104/pp.108.124917
LIGHT-REGULATED WD1 and PSEUDO-RESPONSE REGULATOR9 form a positive feedback regulatory loop in the Arabidopsis circadian clock.2011 · DOI: 10.1105/tpc.110.081661

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_034722 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009718 anthocyanin-containing compound biosynthetic process Biological Process
GO:0009723 response to ethylene Biological Process
GO:0009733 response to auxin Biological Process
GO:0010026 trichome differentiation Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0032880 regulation of protein localization Biological Process
GO:0043153 entrainment of circadian clock by photoperiod Biological Process
GO:0045165 cell fate commitment Biological Process
GO:0048511 rhythmic process Biological Process
GO:0048573 photoperiodism, flowering Biological Process
GO:0090628 plant epidermal cell fate specification Biological Process
GO:0005634 nucleus Cellular Component
KEGG gene cross-reference
ath:AT1G12910
ath:AT3G26640
ath:AT5G24520
hsa:10238
mmu:71833
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.507
Rank 1 · TkA08G429520 · TK1151
Cytoplasm0.495
Rank 2 · TkA08G429520 · TK1151
Lysosome / Vacuole0.115
Rank 3 · TkA08G429520 · TK1151
Golgi apparatus0.076
Rank 4 · TkA08G429520 · TK1151
Cell membrane0.058
Rank 5 · TkA08G429520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23609Beta-prop_EIPR137-286 aa
PF24817WD40_WDHD1_1st42-86 aa
PF00400WD4079-99 aa
PF23381Beta-prop_IFT122_1st81-114 aa
PF29037DSE1_N83-200 aa
PF24814WD40_Prp1990-108 aa
PF23414Beta-prop_EML_295-177 aa
PF25047Beta-prop_TEP1_2nd110-201 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA08G429520PF23609Beta-prop_EIPR1372861.3e-0732.1
TkA08G429520PF24817WD40_WDHD1_1st42867.9e-1039.1
TkA08G429520PF00400WD4079997e-1246.0
TkA08G429520PF23381Beta-prop_IFT122_1st811149.9e-1348.8
TkA08G429520PF29037DSE1_N832001.2e-1248.3
TkA08G429520PF24814WD40_Prp19901086.2e-1452.4
TkA08G429520PF23414Beta-prop_EML_2951773.2e-0627.4
TkA08G429520PF25047Beta-prop_TEP1_2nd1102014.4e-0730.0
TkA08G429520PF03337Pox_F12L1131760.2410.2
TkA08G429520PF23775Beta-prop_RIG_2nd1191675e-0833.4
TkA08G429520PF24817WD40_WDHD1_1st1253177.9e-1039.1
TkA08G429520PF24807WD40_CDC20-Fz1263178.3e-1865.4
TkA08G429520PF25460Beta-prop_Aladin1261824.4e-0523.5
TkA08G429520PF24814WD40_Prp191302066.2e-1452.4
TkA08G429520PF00400WD401301557e-1246.0
TkA08G429520PF12894ANAPC4_WD401301790.0001922.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9XGN1Arabidopsis thalianasp|Q9XGN1|TTG1_ARATH Protein TRANSPARENT TESTA GLABRA 176.600%Swiss-ProtHigh
Q9LPV9Arabidopsis thalianasp|Q9LPV9|LWD1_ARATH WD repeat-containing protein LWD164.100%Swiss-ProtHigh
Q38960Arabidopsis thalianasp|Q38960|LWD2_ARATH WD repeat-containing protein LWD262.600%Swiss-ProtHigh

JBrowse

View in Genome Browser