RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA08G420070
Reference: TK1151 Chr: Chr08 Coordinates: 106802828-106806074 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1431 bp · TkA08G420070|TK1151|cDNA

ATGAGAGGATTGGCGAGAAAGGCTTCAAAAAAGACGTTCGCATTTGGTGAGTTAAGGTACAGTGATAATCAAACGGTTTATGGTTATGTACAGTGTACACCAGATTTATCGGGCTTTGATTGTGGCCGATGCCTTGAAGTGAGTGTTGATGGTTTGGGGGATTATTGTCATGGAAAACAAGGGGCACGAGTGTTGACTCCGAGTTGTAATGTTAGATACGAGACATATAAGTTCCTACGATTTTCATCATCAGGGAAAAA...

CDS

Download CDS FASTA

1431 bp · TkA08G420070|TK1151|CDS

ATGAGAGGATTGGCGAGAAAGGCTTCAAAAAAGACGTTCGCATTTGGTGAGTTAAGGTACAGTGATAATCAAACGGTTTATGGTTATGTACAGTGTACACCAGATTTATCGGGCTTTGATTGTGGCCGATGCCTTGAAGTGAGTGTTGATGGTTTGGGGGATTATTGTCATGGAAAACAAGGGGCACGAGTGTTGACTCCGAGTTGTAATGTTAGATACGAGACATATAAGTTCCTACGATTTTCATCATCAGGGAAAAA...

Protein

Download Protein FASTA

476 aa · TkA08G420070|TK1151|PROTEIN

MRGLARKASKKTFAFGELRYSDNQTVYGYVQCTPDLSGFDCGRCLEVSVDGLGDYCHGKQGARVLTPSCNVRYETYKFLRFSSSGKNKFSTYIIAAIVATVGVLMVIVSVYVFMRKKRRGVAINELEDKIDDNDIITEDSLQFELRAIEAATNNFSLDNKIGEGGFGGVYKGVLGNGQEIAVKRLSKGSGQGAVEFKNEVALLAKLQHRNLVRLLGFCLGTEEKILIYEYVPNHSLDYFLFDPTKQEQVDWLTRYKIIGG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA08G420070
TK1151 IDTkA08G420070
OH-1004 IDLXL04_034665
Relationship / confidenceNon Reciprocal Best Hit / Complex relationship
Protein identity (%)96.500
Protein coverage (%)TK1151 100.000 / OH-1004 74.727
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA08G420070
LocationChr08:106802828-106806074 (-)
DescriptionSimilar to CRK15: Cysteine-rich receptor-like protein kinase 15
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g23180 Cysteine-rich receptor-like protein kinase 10. No verified direct reference in this release
At4g23230 Cysteine-rich receptor-like protein kinase 15. No verified direct reference in this release
At4g23270 Cysteine-rich receptor-like protein kinase 19. No verified direct reference in this release
At4g23160 Cysteine-rich receptor-like protein kinase 8. No verified direct reference in this release
At4g23130 Involved in multiple distinct defense responses. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_034665 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000302 response to reactive oxygen species Biological Process
GO:0006979 response to oxidative stress Biological Process
GO:0007165 signal transduction Biological Process
GO:0009626 plant-type hypersensitive response Biological Process
GO:0042742 defense response to bacterium Biological Process
GO:0005576 extracellular region Cellular Component
GO:0005829 cytosol Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0004672 protein kinase activity Molecular Function
GO:0004674 protein serine/threonine kinase activity Molecular Function
GO:0005524 ATP binding Molecular Function
KEGG gene cross-reference
ath:AT4G05200
ath:AT4G23140
ath:AT4G23180
ath:AT4G23230
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.840
Rank 1 · TkA08G420070 · TK1151
Cytoplasm0.100
Rank 2 · TkA08G420070 · TK1151
Endoplasmic reticulum0.075
Rank 3 · TkA08G420070 · TK1151
Nucleus0.061
Rank 4 · TkA08G420070 · TK1151
Lysosome / Vacuole0.027
Rank 5 · TkA08G420070 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01657Stress-antifung10-76 aa
PF05568ASFV_J13L84-128 aa
PF02009RIFIN86-119 aa
PF15345TMEM5188-123 aa
PF17870Insulin_TMD93-117 aa
PF26324HopBF1_kinase146-209 aa
PF07714PK_Tyr_Ser-Thr156-419 aa
PF00069Pkinase156-357 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA08G420070PF01657Stress-antifung10766.3e-1143.5
TkA08G420070PF05568ASFV_J13L841280.06913.6
TkA08G420070PF02009RIFIN861190.5610.8
TkA08G420070PF15345TMEM51881230.113.1
TkA08G420070PF17870Insulin_TMD931170.004117.9
TkA08G420070PF26324HopBF1_kinase1462090.2111.8
TkA08G420070PF07714PK_Tyr_Ser-Thr1564191.7e-46159.3
TkA08G420070PF00069Pkinase1563575.4e-42144.7
TkA08G420070PF03109ABC11611850.0002820.9
TkA08G420070PF01636APH1792370.05114.0
TkA08G420070PF03109ABC12213030.0002820.9
TkA08G420070PF12330Haspin_kinase2653050.06213.0
TkA08G420070PF01636APH2712920.05114.0
TkA08G420070PF17667Pkinase_fungal2743430.2410.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8GYA4Arabidopsis thalianasp|Q8GYA4|CRK10_ARATH Cysteine-rich receptor-like protein kinase 1051.100%Swiss-ProtHigh
Q8W4G6Arabidopsis thalianasp|Q8W4G6|CRK15_ARATH Cysteine-rich receptor-like protein kinase 1552.600%Swiss-ProtHigh
Q8GWJ7Arabidopsis thalianasp|Q8GWJ7|CRK19_ARATH Cysteine-rich receptor-like protein kinase 1950.500%Swiss-ProtHigh
O65468Arabidopsis thalianasp|O65468|CRK8_ARATH Cysteine-rich receptor-like protein kinase 848.800%Swiss-ProtMedium
Q9C5S8Arabidopsis thalianasp|Q9C5S8|CRK5_ARATH Cysteine-rich receptor-like protein kinase 550.600%Swiss-ProtHigh

JBrowse

View in Genome Browser