TkA08G406380 | RubberDandelionOmics

Gene overview

TkA08G406380

Reference: TK1151 Chr: Chr08 Coordinates: 103417800-103420810 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1057 bp · TkA08G406380|TK1151|cDNA

TGCTGTTTTCCATTATAAAATTTACTGCAAAACTTCAACGTCCCTCTCCTCTCCTCTCGTCTCCACCCTTATGGATTCGGATTTTTGGACCGCTCGTCTCGCCGCCGCGAAGCGGCAATTCACGATGCAACACCACCATCACCACCACCATCAGAGCTCCCATCTGGATCGGTTGAACGCTGATGATTTCGAGGTCGAAGAAGAAATCCGACCCGATTTTCCATGCCCGTATTGCTATGAGGATTTTGACATCGGGTCCT...

CDS

Download CDS FASTA

705 bp · TkA08G406380|TK1151|CDS

ATGGATTCGGATTTTTGGACCGCTCGTCTCGCCGCCGCGAAGCGGCAATTCACGATGCAACACCACCATCACCACCACCATCAGAGCTCCCATCTGGATCGGTTGAACGCTGATGATTTCGAGGTCGAAGAAGAAATCCGACCCGATTTTCCATGCCCGTATTGCTATGAGGATTTTGACATCGGGTCCTTGTGTTCTCATCTCGAAGACGAACACTCTTTTGAATCTAGAGCCACTATTTGTCCGGTTTGCTCGGTTAA...

Protein

Download Protein FASTA

234 aa · TkA08G406380|TK1151|PROTEIN

MDSDFWTARLAAAKRQFTMQHHHHHHHQSSHLDRLNADDFEVEEEIRPDFPCPYCYEDFDIGSLCSHLEDEHSFESRATICPVCSVKVTRDMLSHITLQHGHRRRRLRRVAVPNSQALSLLGRDLREAHLQVLLGSGGGGGGFRSNVTTSSAASVAASDPFLSSLVLNFPASEAEEMSVSNVEESSVKSQAPQHIWKSSFDPSLSSEEREKRMKRAAGQAVFLQDVLISTLLSD

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G406380`
TK1151 ID	TkA08G406380
OH-1004 ID	LXL04_034511
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	92.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G406380

Location Chr08:103417800-103420810 (-)

Description Similar to DI19-1: Protein DEHYDRATION-INDUCED 19

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g26990`	Protein DEHYDRATION-INDUCED 19 homolog 6.	No verified direct reference in this release
`At3g06760`	Protein DEHYDRATION-INDUCED 19 homolog 4.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0562200`	Protein DEHYDRATION-INDUCED 19.	No verified direct reference in this release
`Os02g0304900`	Protein DEHYDRATION-INDUCED 19 homolog 4.	No verified direct reference in this release
`Os01g0672400`	Protein DEHYDRATION-INDUCED 19 homolog 3.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034511 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0003677 DNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G05700

dosa:Os01g0672400

dosa:Os02g0304900

dosa:Os05g0358000

dosa:Os05g0562200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.728

Rank 1 · TkA08G406380 · TK1151

Cytoplasm0.362

Rank 2 · TkA08G406380 · TK1151

Cell membrane0.030

Rank 3 · TkA08G406380 · TK1151

Endoplasmic reticulum0.028

Rank 4 · TkA08G406380 · TK1151

Mitochondrion0.023

Rank 5 · TkA08G406380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05605zf-Di1920-28 aa

PF21039CEP104_ZnF22-25 aa

PF05605zf-Di1949-101 aa

PF24441DUF756049-61 aa

PF26082zf-C2H2_AcuF50-57 aa

PF21039CEP104_ZnF51-97 aa

PF23146Zf_IFT144_1st51-55 aa

PF23146Zf_IFT144_1st78-85 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G406380	`PF05605`	zf-Di19	20	28	1.2e-23	83.8
TkA08G406380	`PF21039`	CEP104_ZnF	22	25	0.081	13.8
TkA08G406380	`PF05605`	zf-Di19	49	101	1.2e-23	83.8
TkA08G406380	`PF24441`	DUF7560	49	61	5.9	7.4
TkA08G406380	`PF26082`	zf-C2H2_AcuF	50	57	5.4	7.5
TkA08G406380	`PF21039`	CEP104_ZnF	51	97	0.081	13.8
TkA08G406380	`PF23146`	Zf_IFT144_1st	51	55	9.4	7.0
TkA08G406380	`PF23146`	Zf_IFT144_1st	78	85	9.4	7.0
TkA08G406380	`PF26082`	zf-C2H2_AcuF	81	88	5.4	7.5
TkA08G406380	`PF24441`	DUF7560	81	93	5.9	7.4
TkA08G406380	`PF14571`	Di19_C	118	231	3.3e-26	92.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6NM26`	Arabidopsis thaliana	sp\|Q6NM26\|DI196_ARATH Protein DEHYDRATION-INDUCED 19 homolog 6	31.800%	Swiss-Prot	Medium
`Q8VXU6`	Arabidopsis thaliana	sp\|Q8VXU6\|DI194_ARATH Protein DEHYDRATION-INDUCED 19 homolog 4	34.100%	Swiss-Prot	Medium
`Q688X9`	Oryza sativa subsp. japonica	sp\|Q688X9\|DI191_ORYSJ Protein DEHYDRATION-INDUCED 19	51.700%	Swiss-Prot	High
`Q6H6E6`	Oryza sativa subsp. japonica	sp\|Q6H6E6\|DI194_ORYSJ Protein DEHYDRATION-INDUCED 19 homolog 4	46.100%	Swiss-Prot	Medium
`Q5QMP3`	Oryza sativa subsp. japonica	sp\|Q5QMP3\|DI193_ORYSJ Protein DEHYDRATION-INDUCED 19 homolog 3	40.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card