LXL04_034511 | RubberDandelionOmics

Gene overview

LXL04_034511

Reference: OH-1004 Chr: Chr07 Coordinates: 103399377-103402324 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

759 bp · LXL04_034511|LXL04_034511|OH1004|cDNA

ATGGATTCGGATTTTTGGACCGCTCGTCTCGCCGCCGCGAAGCGGCAATTCACGATGCAacaccaccatcaccaccaccatcagAGCTCCCATCTGGGTTCGGTTTGTTTTCATCGGTTGAACGCTGATGATTTCGAGGTCGAAGAAGAAATCCGACCCGATTTTCCATGCCCGTATTGCTATGAGGATTTTGACATCGGGTCCTTGTGTTCTCATCTCGAAGACGAACACTCTTTTGAATCTAGAGCCACTATTTGTCC...

CDS

Download CDS FASTA

759 bp · LXL04_034511|LXL04_034511|OH1004|CDS

ATGGATTCGGATTTTTGGACCGCTCGTCTCGCCGCCGCGAAGCGGCAATTCACGATGCAACACCACCATCACCACCACCATCAGAGCTCCCATCTGGGTTCGGTTTGTTTTCATCGGTTGAACGCTGATGATTTCGAGGTCGAAGAAGAAATCCGACCCGATTTTCCATGCCCGTATTGCTATGAGGATTTTGACATCGGGTCCTTGTGTTCTCATCTCGAAGACGAACACTCTTTTGAATCTAGAGCCACTATTTGTCC...

Protein

Download Protein FASTA

252 aa · LXL04_034511|LXL04_034511|OH1004|PROTEIN

MDSDFWTARLAAAKRQFTMQHHHHHHHQSSHLGSVCFHRLNADDFEVEEEIRPDFPCPYCYEDFDIGSLCSHLEDEHSFESRATICPVCSVKVTRDMLSHITLQHGHLFKISFLSYEYLQRRRRLRRVAVPNSQALSLLGRDLREAHLQVLLGSGGGGGGFRSNVTTSSAASVAASDPFLSSLVLNFPASEAEEMSVSNVEESSVKSQAPQHIWKSSFDPSLSSEEREKRMKRAAGQAVFLQDVLISTLLSD

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_034511`
TK1151 ID	TkA08G406380
OH-1004 ID	LXL04_034511
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	92.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_034511

Location Chr07:103399377-103402324 (+)

Description Similar to DI19-1: Protein DEHYDRATION-INDUCED 19

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g05700`	Protein DEHYDRATION-INDUCED 19 homolog 3.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0562200`	Protein DEHYDRATION-INDUCED 19.	No verified direct reference in this release
`Os01g0672400`	Protein DEHYDRATION-INDUCED 19 homolog 3.	No verified direct reference in this release
`Os02g0304900`	Protein DEHYDRATION-INDUCED 19 homolog 4.	No verified direct reference in this release
`Os05g0358000`	Protein DEHYDRATION-INDUCED 19 homolog 2.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034511 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0003677 DNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G05700

dosa:Os01g0672400

dosa:Os02g0304900

dosa:Os05g0358000

dosa:Os05g0562200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.777

Rank 1 · LXL04_034511 · OH-1004

Cytoplasm0.313

Rank 2 · LXL04_034511 · OH-1004

Cell membrane0.028

Rank 3 · LXL04_034511 · OH-1004

Endoplasmic reticulum0.024

Rank 4 · LXL04_034511 · OH-1004

Mitochondrion0.023

Rank 5 · LXL04_034511 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05605.19zf-Di1954-106 aa

PF14571.12Di19_C136-249 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_034511	`PF05605.19`	zf-Di19	54	106	1.3e-23	83.7
LXL04_034511	`PF14571.12`	Di19_C	136	249	4.2e-26	92.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84J70`	Arabidopsis thaliana	Protein DEHYDRATION-INDUCED 19 homolog 3	33.992%	Swiss-Prot	moderate database homology
`Q688X9`	Oryza sativa subsp. japonica	Protein DEHYDRATION-INDUCED 19	49.412%	Swiss-Prot	moderate database homology
`Q5QMP3`	Oryza sativa subsp. japonica	Protein DEHYDRATION-INDUCED 19 homolog 3	43.182%	Swiss-Prot	moderate database homology
`Q6H6E6`	Oryza sativa subsp. japonica	Protein DEHYDRATION-INDUCED 19 homolog 4	49.042%	Swiss-Prot	moderate database homology
`Q5W794`	Oryza sativa subsp. japonica	Protein DEHYDRATION-INDUCED 19 homolog 2	33.668%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card