TkA08G405650 | RubberDandelionOmics

Gene overview

TkA08G405650

Reference: TK1151 Chr: Chr08 Coordinates: 103210420-103215354 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1313 bp · TkA08G405650|TK1151|cDNA

TAACGGAAGTGCTATTGCGGCAACTATTACTACATGGACCAAATTGTCATTTACCAGTTGGAAAATAAAAACTCGACTGCTTATAATCAAAGATGTTCTCCGAAAGTCGTGGAAGAAATAGCTTGGAGCACATTTAAAACCTCTAAACCCTTACCGTTTCTCACACTCTGTTCATCAGTGTACAAAAGAAGCACGACTCTGCTCCAAAGAAATATGGCAAGATCCCCAAAATTGGATAAGGGAGTTAAAGCTCTTATTAC...

CDS

Download CDS FASTA

1026 bp · TkA08G405650|TK1151|CDS

ATGGACCAAATTGTCATTTACCAGTTGGAAAATAAAAACTCGACTGCTTATAATCAAAGATGTTCTCCGAAAGTCGTGGAAGAAATAGCTTGGAGCACATTTAAAACCTCTAAACCCTTACCGTTTCTCACACTCTGTTCATCAGTGTACAAAAGAAGCACGACTCTGCTCCAAAGAAATATGGCAAGATCCCCAAAATTGGATAAGGGAGTTAAAGCTCTTATTACAGCTGGAGTTGTTGGAGGGCTTGGCCTCTATAC...

Protein

Download Protein FASTA

341 aa · TkA08G405650|TK1151|PROTEIN

MDQIVIYQLENKNSTAYNQRCSPKVVEEIAWSTFKTSKPLPFLTLCSSVYKRSTTLLQRNMARSPKLDKGVKALITAGVVGGLGLYTASNTLYNVEGGHRAIVFNRLVGVKDKVYPEGTHVVIPWLERPIIYDVRARPHLVESTSGSRDLQMVKIGLRVLVRPEPNQLPTIYRTLGEDYNERVLPSIIHETLKAVVAQYNASQLLTQRENVSREIRRLLIVRAASFNITLDDVAITGLTFGKEFTHAIEAKQVAAQEAER...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G405650`
TK1151 ID	TkA08G405650
OH-1004 ID	LXL04_034526
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G405650

Location Chr08:103210420-103215354 (+)

Description Similar to PHB6: Prohibitin-6, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g28510`	Prohibitin probably acts as a holdase/unfoldase for the stabilization of newly synthesized mitochondrial proteins.	No verified direct reference in this release
`At2g20530`	Prohibitin probably acts as a holdase/unfoldase for the stabilization of newly synthesized mitochondrial proteins.	No verified direct reference in this release
`At1g03860`	Prohibitin probably acts as a holdase/unfoldase for the stabilization of newly synthesized mitochondrial proteins.	No verified direct reference in this release
`At5g44140`	Prohibitin probably acts as a holdase/unfoldase for the stabilization of newly synthesized mitochondrial proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034526 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000001 mitochondrion inheritance Biological Process

GO:0000423 mitophagy Biological Process

GO:0006457 protein folding Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0045861 negative regulation of proteolysis Biological Process

GO:0050821 protein stabilization Biological Process

GO:0061753 substrate localization to autophagosome Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

KEGG gene cross-reference

ath:AT1G03860

ath:AT2G20530

ath:AT4G28510

ath:AT5G44140

sce:YGR231C

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.837

Rank 1 · TkA08G405650 · TK1151

Plastid0.102

Rank 2 · TkA08G405650 · TK1151

Cytoplasm0.094

Rank 3 · TkA08G405650 · TK1151

Nucleus0.078

Rank 4 · TkA08G405650 · TK1151

Cell membrane0.060

Rank 5 · TkA08G405650 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01145Band_794-271 aa

PF12469Cmr2_N154-215 aa

PF12469Cmr2_N284-284 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G405650	`PF01145`	Band_7	94	271	5.8e-31	108.5
TkA08G405650	`PF12469`	Cmr2_N	154	215	0.17	12.7
TkA08G405650	`PF12469`	Cmr2_N	284	284	0.17	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O49460`	Arabidopsis thaliana	sp\|O49460\|PHB1_ARATH Prohibitin-1, mitochondrial	76.000%	Swiss-Prot	High
`Q9SIL6`	Arabidopsis thaliana	sp\|Q9SIL6\|PHB6_ARATH Prohibitin-6, mitochondrial	76.100%	Swiss-Prot	High
`Q9ZNT7`	Arabidopsis thaliana	sp\|Q9ZNT7\|PHB2_ARATH Prohibitin-2, mitochondrial	73.000%	Swiss-Prot	High
`Q9FFH5`	Arabidopsis thaliana	sp\|Q9FFH5\|PHB7_ARATH Prohibitin-7, mitochondrial	70.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card