TkA08G340550 | RubberDandelionOmics

Gene overview

TkA08G340550

Reference: TK1151 Chr: Chr08 Coordinates: 87318102-87320217 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1941 bp · TkA08G340550|TK1151|cDNA

CAATTAACTCATTAAGTCACAGTATCATCAGTGATTCAGTGGCCTCCCTCAACTTTCCTGGTCCATCGCCACTCTCCCGTTATCAGCTCCATCTACACGATGGAAGTAGACTCCAAAATTCTCAATGTGGGTGCGCTCCTCATCGCCACTCTCGTGGCTGCTAAAATCATCGCCGCCTTCTTGATCCCCAGATCCCGTAAACGTCTTCCGCCCGTCGTCAAAGCTTTTCCGGTCGTCGGGGGGTTGTTACGGTTCTTGAA...

CDS

Download CDS FASTA

1455 bp · TkA08G340550|TK1151|CDS

ATGGAAGTAGACTCCAAAATTCTCAATGTGGGTGCGCTCCTCATCGCCACTCTCGTGGCTGCTAAAATCATCGCCGCCTTCTTGATCCCCAGATCCCGTAAACGTCTTCCGCCCGTCGTCAAAGCTTTTCCGGTCGTCGGGGGGTTGTTACGGTTCTTGAAAGGACCAATTGTCATGCTCAGACAGGAATACCCTAAATTAGGGAGCGTATTCACTCTCAACCTCGTGAACAAAAACATCACGTTCTTAATCGGACCTGA...

Protein

Download Protein FASTA

484 aa · TkA08G340550|TK1151|PROTEIN

MEVDSKILNVGALLIATLVAAKIIAAFLIPRSRKRLPPVVKAFPVVGGLLRFLKGPIVMLRQEYPKLGSVFTLNLVNKNITFLIGPEVSAHFFKASESDLSQQEVYQFNVPTFGPGVVFDVDYSVRQEQFRFFTESLRVNKLKGYVDHMVFEATEYFSKWGESGEVDLKDELEKLIILTASRCLLGEEVRNKLFDDVSALFHDLDNGMLPISVIFPYLPIPAHRRRDQARKKLADIFAKIISSRKQSGKSENDMLQCFID...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G340550`
TK1151 ID	TkA08G340550
OH-1004 ID	LXL04_030348
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	26.900
Protein coverage (%)	TK1151 95.455 / OH-1004 93.776 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G340550

Location Chr08:87318102-87320217 (+)

Description Similar to CYP707A1: Abscisic acid 8'-hydroxylase CYP707A1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g11680`	Involved in sterol biosynthesis.	Arabidopsis cyp51 mutant shows postembryonic seedling lethality associated with lack of membrane integrity.2005 · DOI: 10.1104/pp.105.061598 Lipid signaling in plants. Cloning and expression analysis of the obtusifoliol 14alpha-demethylase from Solanum chacoense Bitt., a pollination- and fertilization-induced gene with both obtusifoliol and lanosterol demethylase activity.2005 · DOI: 10.1104/pp.105.066639

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030348 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009414 response to water deprivation Biological Process

GO:0009733 response to auxin Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009856 pollination Biological Process

GO:0016125 sterol metabolic process Biological Process

GO:0046345 abscisic acid catabolic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0016020 membrane Cellular Component

GO:0005506 iron ion binding Molecular Function

GO:0010295 (+)-abscisic acid 8'-hydroxylase activity Molecular Function

GO:0020037 heme binding Molecular Function

KEGG gene cross-reference

ath:AT3G19270

dosa:Os09g0457100

sly:100136887

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.908

Rank 1 · TkA08G340550 · TK1151

Cytoplasm0.063

Rank 2 · TkA08G340550 · TK1151

Nucleus0.046

Rank 3 · TkA08G340550 · TK1151

Golgi apparatus0.045

Rank 4 · TkA08G340550 · TK1151

Cell membrane0.037

Rank 5 · TkA08G340550 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00067p45037-455 aa

PF26838Phage_T4_Y01E165-203 aa

PF26838Phage_T4_Y01E306-337 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G340550	`PF00067`	p450	37	455	1.1e-63	216.4
TkA08G340550	`PF26838`	Phage_T4_Y01E	165	203	0.041	15.3
TkA08G340550	`PF26838`	Phage_T4_Y01E	306	337	0.041	15.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SAA9`	Arabidopsis thaliana	sp\|Q9SAA9\|CP511_ARATH Sterol 14-demethylase	82.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card