TkA08G330840 | RubberDandelionOmics

Gene overview

TkA08G330840

Reference: TK1151 Chr: Chr08 Coordinates: 85112321-85117102 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1419 bp · TkA08G330840|TK1151|cDNA

CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTTGTATGTGTGTATGTGTTTGTTTGTGTCTCTCTCTATCCCGTGTATTGAAAGTGGAGGTTTATCTTAGGCAAGAAATGCATCTACATATGCACTTGTTTATACTGCTAACAATCTTTTCGTCAAAGGTCTCTTGTTCTGGTCATAAAAAAATTAATCATCGACCCCAGACTAAGCCACAGCTGGTCAATGTAGACGATTATGGAGCCACTGGTAACGGCACTGA...

CDS

Download CDS FASTA

1290 bp · TkA08G330840|TK1151|CDS

ATGTGTGTATGTGTTTGTTTGTGTCTCTCTCTATCCCGTGTATTGAAAGTGGAGGTTTATCTTAGGCAAGAAATGCATCTACATATGCACTTGTTTATACTGCTAACAATCTTTTCGTCAAAGGTCTCTTGTTCTGGTCATAAAAAAATTAATCATCGACCCCAGACTAAGCCACAGCTGGTCAATGTAGACGATTATGGAGCCACTGGTAACGGCACTGATGAGTCTGAGGCATTTATGAAAGCATGGAGGAACGCCTG...

Protein

Download Protein FASTA

429 aa · TkA08G330840|TK1151|PROTEIN

MCVCVCLCLSLSRVLKVEVYLRQEMHLHMHLFILLTIFSSKVSCSGHKKINHRPQTKPQLVNVDDYGATGNGTDESEAFMKAWRNACDTFSGSEFVVPENKVYHLKPITFSGPCKPNLKFKIYGTLKASSRRSDYDQERKRWITFKHLENFVVEGGGTINGNGRIWWIKSCKIDENQPCKDAPTAVTFKNCKSLRVNNIRIKNPQQIHLTFLNSVNVRASNLRLIAPGNSPNTDGLHVSDSQNVRIINSVVKTGDDCVSI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G330840`
TK1151 ID	TkA08G330840
OH-1004 ID	LXL04_034027
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.500
Protein coverage (%)	TK1151 92.774 / OH-1004 92.938 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G330840

Location Chr08:85112321-85117102 (+)

Description Similar to Polygalacturonase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g07970`	Polygalacturonase required for cell type-specific pectin degradation to separate microspores.	ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE1 (ADPG1), ADPG2, and QUARTET2 are Polygalacturonases required for cell separation during reproductive development in Arabidopsis.2009 · DOI: 10.1105/tpc.108.063768 Tetrad analysis possible in Arabidopsis with mutation of the QUARTET (QRT) genes.1994 · DOI: 10.1126/science.8197459

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034027 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0009830 cell wall modification involved in abscission Biological Process

GO:0009835 fruit ripening Biological Process

GO:0009901 anther dehiscence Biological Process

GO:0010047 fruit dehiscence Biological Process

GO:0045490 pectin catabolic process Biological Process

GO:0048235 pollen sperm cell differentiation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0048046 apoplast Cellular Component

GO:0004650 polygalacturonase activity Molecular Function

KEGG gene cross-reference

ath:AT3G07970

sly:544051

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.648

Rank 1 · TkA08G330840 · TK1151

Cytoplasm0.102

Rank 2 · TkA08G330840 · TK1151

Lysosome / Vacuole0.086

Rank 3 · TkA08G330840 · TK1151

Cell membrane0.086

Rank 4 · TkA08G330840 · TK1151

Endoplasmic reticulum0.080

Rank 5 · TkA08G330840 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12708Pect-lyase_RHGA_epim61-94 aa

PF00295Glyco_hydro_2887-416 aa

PF12708Pect-lyase_RHGA_epim208-312 aa

PF12708Pect-lyase_RHGA_epim321-402 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G330840	`PF12708`	Pect-lyase_RHGA_epim	61	94	0.016	15.7
TkA08G330840	`PF00295`	Glyco_hydro_28	87	416	1.3e-98	330.8
TkA08G330840	`PF12708`	Pect-lyase_RHGA_epim	208	312	0.016	15.7
TkA08G330840	`PF12708`	Pect-lyase_RHGA_epim	321	402	0.016	15.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SFB7`	Arabidopsis thaliana	sp\|Q9SFB7\|QRT2_ARATH Polygalacturonase QRT2	55.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card