RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA08G263080
Reference: TK1151 Chr: Chr08 Coordinates: 68600469-68606218 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

4036 bp · TkA08G263080|TK1151|cDNA

ATACCTCATATTTTGCAATTTAGCATACTTATAGTTGTAAATAAGTGATGCCTTAAAGAAGTTAGTGAAGTTTTGAGATAAATATTAAATTTCGTATTGATATTATAATTTGTTTTCGAATGGTTAGATACTAAAGCGATGATTAACGACCATCAATTTTAATTTAGTAGTTGCATGGCATCGAGAGATCCTGGTGTCCGTACGCATTGCCTCATTCTTCGTCCTCCTTCCTCTGACCTTTTCACCCTCATCCTCTATCT...

CDS

Download CDS FASTA

3435 bp · TkA08G263080|TK1151|CDS

ATGAGCCAGGGGTTGGATGACGGCGATGCCGACGCCTTGTCTGCTCTGGCCAACGCTCCTCCGCCTTCCACCGCCGGCACCAGGAAAACACATTCCCAACAGCTCCGTACAAACACCGGTACCAACTTCAAACGCCACCTAAACCAGAACCACCGCCAGCACAGCCTTGATGAGGCCCGTATGTCCGCCGTTGTTGAAGGATTTCGTAACCACTCCGACGAGGACGACGATCATGACTTTTATCCTTACGCCACATCTTC...

Protein

Download Protein FASTA

1144 aa · TkA08G263080|TK1151|PROTEIN

MSQGLDDGDADALSALANAPPPSTAGTRKTHSQQLRTNTGTNFKRHLNQNHRQHSLDEARMSAVVEGFRNHSDEDDDHDFYPYATSSSLESSHSDPNGQHYLGNNNSNSRNSNSSSSFDDQHPLPEFSGSGGGAGIFKAPSRSAVHPGRPTALELRPHPLKETQVGRFIRTIACTETQLWAGQESGVRFWNFSDAFEPGLGIGGRARRGDEDAAPFYESVNTSPTTCLMTECASKLVMSGHKDGKIRSWKMDQKPVDDTP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA08G263080
TK1151 IDTkA08G263080
OH-1004 IDLXL04_033415
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)94.500
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA08G263080
LocationChr08:68600469-68606218 (-)
DescriptionSimilar to IP5P12: Type I inositol polyphosphate 5-phosphatase 12
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g43900 May have phosphatase activity toward Ins(1,4,5)P₃.
Molecular and biochemical characterization of three WD-repeat-domain-containing inositol polyphosphate 5-phosphatases in Arabidopsis thaliana.2004 · DOI: 10.1093/pcp/pch187
At1g05630 Converts inositol 1,4,5-trisphosphate (Ins(1,4,5)P3) to inositol 1,4-bisphosphate.
Molecular and biochemical characterization of three WD-repeat-domain-containing inositol polyphosphate 5-phosphatases in Arabidopsis thaliana.2004 · DOI: 10.1093/pcp/pch187
At5PTase13 modulates cotyledon vein development through regulating auxin homeostasis.2005 · DOI: 10.1104/pp.105.067140
An inositol polyphosphate 5-phosphatase functions in PHOTOTROPIN1 signaling in Arabidopis by altering cytosolic Ca2+.2008 · DOI: 10.1105/tpc.107.052670
The role of Arabidopsis 5PTase13 in root gravitropism through modulation of vesicle trafficking.2009 · DOI: 10.1038/cr.2009.105
At2g31830 May have phosphatase activity toward PtdIns(4,5)P₂, PtdIns(3,4,5)P₃ and Ins(1,4,5)P₃.
Molecular and biochemical characterization of three WD-repeat-domain-containing inositol polyphosphate 5-phosphatases in Arabidopsis thaliana.2004 · DOI: 10.1093/pcp/pch187
At1g65580 May have phosphatase activity toward PtdIns(4,5)P₂, PtdIns(3,4,5)P₃ and Ins(1,4,5)P₃.
FRAGILE FIBER3, an Arabidopsis gene encoding a type II inositol polyphosphate 5-phosphatase, is required for secondary wall synthesis and actin organization in fiber cells.2004 · DOI: 10.1105/tpc.104.027466

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_033415 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0007165 signal transduction Biological Process
GO:0007584 response to nutrient Biological Process
GO:0009611 response to wounding Biological Process
GO:0009630 gravitropism Biological Process
GO:0009637 response to blue light Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0009743 response to carbohydrate Biological Process
GO:0009846 pollen germination Biological Process
GO:0010087 phloem or xylem histogenesis Biological Process
GO:0010182 sugar mediated signaling pathway Biological Process
GO:0043647 inositol phosphate metabolic process Biological Process
GO:0046856 phosphatidylinositol dephosphorylation Biological Process
KEGG gene cross-reference
ath:AT1G05630
ath:AT1G65580
ath:AT2G31830
ath:AT2G43900
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.488
Rank 1 · TkA08G263080 · TK1151
Nucleus0.276
Rank 2 · TkA08G263080 · TK1151
Cell membrane0.242
Rank 3 · TkA08G263080 · TK1151
Lysosome / Vacuole0.118
Rank 4 · TkA08G263080 · TK1151
Golgi apparatus0.116
Rank 5 · TkA08G263080 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07494Reg_prop95-106 aa
PF23754Beta-prop_IP5PC_F160-557 aa
PF25173Beta-prop_WDR3_1st221-254 aa
PF23410Beta-prop_VPS8221-258 aa
PF24805EIF3I221-254 aa
PF24817WD40_WDHD1_1st223-254 aa
PF24807WD40_CDC20-Fz226-303 aa
PF23381Beta-prop_IFT122_1st226-260 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA08G263080PF07494Reg_prop951061.210.3
TkA08G263080PF23754Beta-prop_IP5PC_F1605574.1e-216718.1
TkA08G263080PF25173Beta-prop_WDR3_1st2212540.0001722.1
TkA08G263080PF23410Beta-prop_VPS82212580.01215.4
TkA08G263080PF24805EIF3I2212540.1511.9
TkA08G263080PF24817WD40_WDHD1_1st2232540.0214.8
TkA08G263080PF24807WD40_CDC20-Fz2263030.01115.8
TkA08G263080PF23381Beta-prop_IFT122_1st2262600.04613.8
TkA08G263080PF24796WDR552262510.07812.7
TkA08G263080PF00400WD402322499.47.7
TkA08G263080PF23409Beta-prop_EML2333078.8e-0832.7
TkA08G263080PF25047Beta-prop_TEP1_2nd2343080.0009719.1
TkA08G263080PF24817WD40_WDHD1_1st2693000.0214.8
TkA08G263080PF24796WDR552723010.07812.7
TkA08G263080PF00400WD402732989.47.7
TkA08G263080PF07494Reg_prop2742921.210.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
O80560Arabidopsis thalianasp|O80560|IP5PC_ARATH Type I inositol polyphosphate 5-phosphatase 1264.100%Swiss-ProtHigh
Q9SYK4Arabidopsis thalianasp|Q9SYK4|IP5PD_ARATH Type I inositol polyphosphate 5-phosphatase 1361.700%Swiss-ProtHigh
Q9SKB7Arabidopsis thalianasp|Q9SKB7|IP5PE_ARATH Type II inositol polyphosphate 5-phosphatase 1462.600%Swiss-ProtHigh
Q84W55Arabidopsis thalianasp|Q84W55|IP5PF_ARATH Type II inositol polyphosphate 5-phosphatase 1554.900%Swiss-ProtHigh

JBrowse

View in Genome Browser