RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_033415
Reference: OH-1004 Chr: Chr07 Coordinates: 43282074-43287198 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3636 bp · LXL04_033415|LXL04_033415|OH1004|cDNA

ATGAGCCAGGGGTTGGATGACGGCGATGCCGACGCCTTGTCTGCTCTGGCCAACGCTCCTCCGCCTTCCACCGCCGGCACCAGGAAAACACATTCCCAACAGCTCCGTACAAACACCGGTACCAACTTCAAACGCCACCTAAACCAGAACCACCGCCAGCACAGCCTTGATGAGGCCCGTATGTCCGCCGTTGTTGAAGGATTTCGTAACCACTCCGACGAGGACGACGATCATGACTTTTATCCTTACGCCACATCTTC...

CDS

Download CDS FASTA

3636 bp · LXL04_033415|LXL04_033415|OH1004|CDS

ATGAGCCAGGGGTTGGATGACGGCGATGCCGACGCCTTGTCTGCTCTGGCCAACGCTCCTCCGCCTTCCACCGCCGGCACCAGGAAAACACATTCCCAACAGCTCCGTACAAACACCGGTACCAACTTCAAACGCCACCTAAACCAGAACCACCGCCAGCACAGCCTTGATGAGGCCCGTATGTCCGCCGTTGTTGAAGGATTTCGTAACCACTCCGACGAGGACGACGATCATGACTTTTATCCTTACGCCACATCTTC...

Protein

Download Protein FASTA

1211 aa · LXL04_033415|LXL04_033415|OH1004|PROTEIN

MSQGLDDGDADALSALANAPPPSTAGTRKTHSQQLRTNTGTNFKRHLNQNHRQHSLDEARMSAVVEGFRNHSDEDDDHDFYPYATSSSLESSHSDPNGQHYLGNNNSNSRNSNSSSSFDDQHPLPEFSGSGGGAGIFKAPSRSAVHPGRPTALELRPHPLKETQVGRFIRTIACTETQLWAGQESGVRFWNFSDAFEPGLGIGGRARRGDEDAAPFYESVNTSPTTCLMTECASKLVMSGHKDGKIRSWKMDQKPVDDTP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_033415
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_033415
LocationChr07:43282074-43287198 (-)
DescriptionSimilar to IP5P12: Type I inositol polyphosphate 5-phosphatase 12
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g43900 May have phosphatase activity toward Ins(1,4,5)P₃.
Molecular and biochemical characterization of three WD-repeat-domain-containing inositol polyphosphate 5-phosphatases in Arabidopsis thaliana.2004 · DOI: 10.1093/pcp/pch187
At1g05630 Converts inositol 1,4,5-trisphosphate (Ins(1,4,5)P3) to inositol 1,4-bisphosphate.
Molecular and biochemical characterization of three WD-repeat-domain-containing inositol polyphosphate 5-phosphatases in Arabidopsis thaliana.2004 · DOI: 10.1093/pcp/pch187
At5PTase13 modulates cotyledon vein development through regulating auxin homeostasis.2005 · DOI: 10.1104/pp.105.067140
An inositol polyphosphate 5-phosphatase functions in PHOTOTROPIN1 signaling in Arabidopis by altering cytosolic Ca2+.2008 · DOI: 10.1105/tpc.107.052670
The role of Arabidopsis 5PTase13 in root gravitropism through modulation of vesicle trafficking.2009 · DOI: 10.1038/cr.2009.105
At2g31830 May have phosphatase activity toward PtdIns(4,5)P₂, PtdIns(3,4,5)P₃ and Ins(1,4,5)P₃.
Molecular and biochemical characterization of three WD-repeat-domain-containing inositol polyphosphate 5-phosphatases in Arabidopsis thaliana.2004 · DOI: 10.1093/pcp/pch187
At1g65580 May have phosphatase activity toward PtdIns(4,5)P₂, PtdIns(3,4,5)P₃ and Ins(1,4,5)P₃.
FRAGILE FIBER3, an Arabidopsis gene encoding a type II inositol polyphosphate 5-phosphatase, is required for secondary wall synthesis and actin organization in fiber cells.2004 · DOI: 10.1105/tpc.104.027466

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_033415 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0007165 signal transduction Biological Process
GO:0007584 response to nutrient Biological Process
GO:0009611 response to wounding Biological Process
GO:0009630 gravitropism Biological Process
GO:0009637 response to blue light Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0009743 response to carbohydrate Biological Process
GO:0009846 pollen germination Biological Process
GO:0010087 phloem or xylem histogenesis Biological Process
GO:0010182 sugar mediated signaling pathway Biological Process
GO:0043647 inositol phosphate metabolic process Biological Process
GO:0046856 phosphatidylinositol dephosphorylation Biological Process
KEGG gene cross-reference
ath:AT1G05630
ath:AT1G65580
ath:AT2G31830
ath:AT2G43900
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.395
Rank 1 · LXL04_033415 · OH-1004
Nucleus0.263
Rank 2 · LXL04_033415 · OH-1004
Cell membrane0.239
Rank 3 · LXL04_033415 · OH-1004
Golgi apparatus0.154
Rank 4 · LXL04_033415 · OH-1004
Lysosome / Vacuole0.121
Rank 5 · LXL04_033415 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23754.2Beta-prop_IP5PC_F160-368 aa
PF23754.2Beta-prop_IP5PC_F398-587 aa
PF22669.3Exo_endo_phos2621-991 aa
PF03372.30Exo_endo_phos621-987 aa
PF23755.2Ig-like_IP5PC_F1030-1163 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_033415PF23754.2Beta-prop_IP5PC_F1603683.2e-208692.1
LXL04_033415PF23754.2Beta-prop_IP5PC_F3985873.2e-208692.1
LXL04_033415PF22669.3Exo_endo_phos26219911.8e-65222.1
LXL04_033415PF03372.30Exo_endo_phos6219873.7e-0834.1
LXL04_033415PF23755.2Ig-like_IP5PC_F103011638.1e-53178.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
O80560Arabidopsis thalianaType I inositol polyphosphate 5-phosphatase 1260.720%Swiss-Protstrong database homology
Q9SYK4Arabidopsis thalianaType I inositol polyphosphate 5-phosphatase 1357.417%Swiss-Protstrong database homology
Q9SKB7Arabidopsis thalianaType II inositol polyphosphate 5-phosphatase 1454.438%Swiss-Protstrong database homology
Q84W55Arabidopsis thalianaType II inositol polyphosphate 5-phosphatase 1553.795%Swiss-Protstrong database homology

JBrowse

View in Genome Browser