TkA08G262280 | RubberDandelionOmics

Gene overview

TkA08G262280

Reference: TK1151 Chr: Chr08 Coordinates: 68399663-68405429 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4049 bp · TkA08G262280|TK1151|cDNA

CTATATACCTCATATTTTGCAATTTAAGCATACTTATAGTTGTAAATAAGTGATGCGTTAAAGAAGTTAGTGAAGTTTTGAGATAAAGATTAAATTTCGTATTGATATTATAATTTGTTTTCGAATGGTTAGATACTAAAGAGATGATTAACGACCATCAATTTTAATTTAGTAGTTGCATGGCATCGAGAGATCCTGGTGTCCGTACGCATTGCCTCATTCTTCGTCCTCCTTCCTCTGACCTTTTCACCCTCATCCTC...

CDS

Download CDS FASTA

2490 bp · TkA08G262280|TK1151|CDS

ATGGCTGCTTTGCTAGTTGAACGTTCAAGTATCGACCTTAAAAGCCAAGCCACCATTAATGGCGTCTGTCACATTTCCTCTTCCGATGTCAAGTTTCTGTTATCCGATAAAGTAAAAGCAAAAATATGGGCAGCTGGGTCCCTCAGTTTCTCACTGTGGGACGCTCGTACGAGGGAGCTTCTCAGAGTTTACAACGTCGACGGTCAAATCGACAACCGGCTCGACGCGTCATCGGAAAGAGAACACCCACCAGAAGAAGA...

Protein

Download Protein FASTA

829 aa · TkA08G262280|TK1151|PROTEIN

MAALLVERSSIDLKSQATINGVCHISSSDVKFLLSDKVKAKIWAAGSLSFSLWDARTRELLRVYNVDGQIDNRLDASSEREHPPEEEVSIKPTNSKSKKEKQQGGGFLQRSRNAIIGAADAVRRVATKGTGAFAAEDAKKTEALLLAYDGSIWTGCSNGLIVQWDANGNRLHDFHHHHCAVLCFCTYGPRIWVGYVSGMVQVIDLEGNLIAGWIAHNGPVIKMVVGNGSVFSLATHGGIRGWYISSPGPLDNILRPELSK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G262280`
TK1151 ID	TkA08G262280
OH-1004 ID	LXL04_033415
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	92.000
Protein coverage (%)	TK1151 100.000 / OH-1004 73.988 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G262280

Location Chr08:68399663-68405429 (+)

Description Similar to IP5P12: Type I inositol polyphosphate 5-phosphatase 12

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g43900`	May have phosphatase activity toward Ins(1,4,5)P₃.	Molecular and biochemical characterization of three WD-repeat-domain-containing inositol polyphosphate 5-phosphatases in Arabidopsis thaliana.2004 · DOI: 10.1093/pcp/pch187
`At1g05630`	Converts inositol 1,4,5-trisphosphate (Ins(1,4,5)P3) to inositol 1,4-bisphosphate.	Molecular and biochemical characterization of three WD-repeat-domain-containing inositol polyphosphate 5-phosphatases in Arabidopsis thaliana.2004 · DOI: 10.1093/pcp/pch187 At5PTase13 modulates cotyledon vein development through regulating auxin homeostasis.2005 · DOI: 10.1104/pp.105.067140 An inositol polyphosphate 5-phosphatase functions in PHOTOTROPIN1 signaling in Arabidopis by altering cytosolic Ca2+.2008 · DOI: 10.1105/tpc.107.052670 The role of Arabidopsis 5PTase13 in root gravitropism through modulation of vesicle trafficking.2009 · DOI: 10.1038/cr.2009.105
`At2g31830`	May have phosphatase activity toward PtdIns(4,5)P₂, PtdIns(3,4,5)P₃ and Ins(1,4,5)P₃.	Molecular and biochemical characterization of three WD-repeat-domain-containing inositol polyphosphate 5-phosphatases in Arabidopsis thaliana.2004 · DOI: 10.1093/pcp/pch187
`At1g65580`	May have phosphatase activity toward PtdIns(4,5)P₂, PtdIns(3,4,5)P₃ and Ins(1,4,5)P₃.	FRAGILE FIBER3, an Arabidopsis gene encoding a type II inositol polyphosphate 5-phosphatase, is required for secondary wall synthesis and actin organization in fiber cells.2004 · DOI: 10.1105/tpc.104.027466

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033415 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0007584 response to nutrient Biological Process

GO:0009611 response to wounding Biological Process

GO:0009630 gravitropism Biological Process

GO:0009637 response to blue light Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009743 response to carbohydrate Biological Process

GO:0009846 pollen germination Biological Process

GO:0010087 phloem or xylem histogenesis Biological Process

GO:0010182 sugar mediated signaling pathway Biological Process

GO:0043647 inositol phosphate metabolic process Biological Process

GO:0046856 phosphatidylinositol dephosphorylation Biological Process

KEGG gene cross-reference

ath:AT1G05630

ath:AT1G65580

ath:AT2G31830

ath:AT2G43900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.541

Rank 1 · TkA08G262280 · TK1151

Nucleus0.257

Rank 2 · TkA08G262280 · TK1151

Cell membrane0.198

Rank 3 · TkA08G262280 · TK1151

Golgi apparatus0.158

Rank 4 · TkA08G262280 · TK1151

Lysosome / Vacuole0.141

Rank 5 · TkA08G262280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23754Beta-prop_IP5PC_F1-242 aa

PF23409Beta-prop_EML127-187 aa

PF23410Beta-prop_VPS8141-222 aa

PF25047Beta-prop_TEP1_2nd154-222 aa

PF22669Exo_endo_phos2276-609 aa

PF03372Exo_endo_phos276-605 aa

PF00635Motile_Sperm604-635 aa

PF00635Motile_Sperm646-683 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G262280	`PF23754`	Beta-prop_IP5PC_F	1	242	2.3e-126	422.5
TkA08G262280	`PF23409`	Beta-prop_EML	127	187	0.0023	18.2
TkA08G262280	`PF23410`	Beta-prop_VPS8	141	222	0.21	11.2
TkA08G262280	`PF25047`	Beta-prop_TEP1_2nd	154	222	0.032	14.1
TkA08G262280	`PF22669`	Exo_endo_phos2	276	609	1.2e-67	229.2
TkA08G262280	`PF03372`	Exo_endo_phos	276	605	5.9e-09	36.7
TkA08G262280	`PF00635`	Motile_Sperm	604	635	0.018	15.6
TkA08G262280	`PF00635`	Motile_Sperm	646	683	0.018	15.6
TkA08G262280	`PF23755`	Ig-like_IP5PC_F	648	781	1.6e-52	177.6
TkA08G262280	`PF22076`	Cep192_D6	660	688	0.073	14.0
TkA08G262280	`PF00635`	Motile_Sperm	708	770	0.018	15.6
TkA08G262280	`PF22076`	Cep192_D6	708	738	0.073	14.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80560`	Arabidopsis thaliana	sp\|O80560\|IP5PC_ARATH Type I inositol polyphosphate 5-phosphatase 12	66.400%	Swiss-Prot	High
`Q9SYK4`	Arabidopsis thaliana	sp\|Q9SYK4\|IP5PD_ARATH Type I inositol polyphosphate 5-phosphatase 13	65.800%	Swiss-Prot	High
`Q9SKB7`	Arabidopsis thaliana	sp\|Q9SKB7\|IP5PE_ARATH Type II inositol polyphosphate 5-phosphatase 14	62.800%	Swiss-Prot	High
`Q84W55`	Arabidopsis thaliana	sp\|Q84W55\|IP5PF_ARATH Type II inositol polyphosphate 5-phosphatase 15	55.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card