TkA08G258290 | RubberDandelionOmics

Gene overview

TkA08G258290

Reference: TK1151 Chr: Chr08 Coordinates: 67354102-67356220 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1266 bp · TkA08G258290|TK1151|cDNA

ATTAGCGAGAGTAAAACCACTTAAACGTCGTCGTATAGAGTCTTTCCCAGAGGAAGAAACAAAACGAAGATAAACAAAGCTTCTGGAAACGTCGCTTCTATATATAAAACCCCCCATTCTGTCTTTAGGGTTTTGTTATCCTCTCGGTTATCAGTCAAATTCTAGTACTACCACAGCAACCACCTCATCTCTCCCCAAGCTTTAGGAAATGGCAGCTGCTCAGTTAACATCGACATGCTTTCTTCCGTCGTTTGAAGGTC...

CDS

Download CDS FASTA

756 bp · TkA08G258290|TK1151|CDS

ATGGCAGCTGCTCAGTTAACATCGACATGCTTTCTTCCGTCGTTTGAAGGTCTGAGGTCTTCGACATCCAAAGTTTCATCGATTGTGGTGTCTTCTCCCTTTAGAAGTTCGACACTCAGGTCAACCCGTAGTCTGGTCGTCAAGTCCGCTACTACCGTTGCTCCCAAGTACACTTCATTAAAGCCATTAGGAGATAGAGTGTTGATAAAAATCAAGGCTGCTGAGGAGAAAAGTGCAGGTGGCATCCTACTCCCATCAAC...

Protein

Download Protein FASTA

251 aa · TkA08G258290|TK1151|PROTEIN

MAAAQLTSTCFLPSFEGLRSSTSKVSSIVVSSPFRSSTLRSTRSLVVKSATTVAPKYTSLKPLGDRVLIKIKAAEEKSAGGILLPSTAQTKPQGGEVVAVGEGRAIGPHKVEIGVKTGAPVVYSKYAGTEVEFNGSKHLILNEDDIVGILETEDIKDLKPLNDRVLIKVQEAEQTTAGGLLLTQASKEKPSIGTVIAVGPGPLDEEGKRKELPLSPGNTVLYSKYAGNDFKGTDGSEYIALRSSDVMAVLS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G258290`
TK1151 ID	TkA08G258290
OH-1004 ID	LXL04_033459
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.600
Protein coverage (%)	TK1151 90.438 / OH-1004 31.927 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G258290

Location Chr08:67354102-67356220 (+)

Description Similar to CPN20: 20 kDa chaperonin, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g20720`	Seems to function only as a co-chaperone, along with CPN60, and in certain cases is essential for the discharge of biologically active proteins from CPN60.	CHAPERONIN 20 mediates iron superoxide dismutase (FeSOD) activity independent of its co-chaperonin role in Arabidopsis chloroplasts.2013 · DOI: 10.1111/j.1469-8137.2012.04369.x Cochaperonin CPN20 negatively regulates abscisic acid signaling in Arabidopsis.2013 · DOI: 10.1007/s11103-013-0082-8

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033459 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0009409 response to cold Biological Process

GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process

GO:0051290 protein heterotetramerization Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0009941 chloroplast envelope Cellular Component

KEGG gene cross-reference

ath:AT5G20720

tex:Teth514_0512

tpd:Teth39_1722

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.983

Rank 1 · TkA08G258290 · TK1151

Mitochondrion0.030

Rank 2 · TkA08G258290 · TK1151

Cytoplasm0.014

Rank 3 · TkA08G258290 · TK1151

Nucleus0.011

Rank 4 · TkA08G258290 · TK1151

Cell membrane0.010

Rank 5 · TkA08G258290 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00166Cpn1060-149 aa

PF20676Herpes_gp350_B130-237 aa

PF00166Cpn10158-249 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G258290	`PF00166`	Cpn10	60	149	5e-60	200.3
TkA08G258290	`PF20676`	Herpes_gp350_B	130	237	0.021	15.3
TkA08G258290	`PF00166`	Cpn10	158	249	5e-60	200.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O65282`	Arabidopsis thaliana	sp\|O65282\|CH20_ARATH 20 kDa chaperonin, chloroplastic	72.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card