TkA08G258250 | RubberDandelionOmics

Gene overview

TkA08G258250

Reference: TK1151 Chr: Chr08 Coordinates: 67337069-67340530 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1616 bp · TkA08G258250|TK1151|cDNA

CCCTTCGTGTTTAGCACTCTTCTCCAGTTCTCCTTTTTAGAAGCAATCAAATAGGACCTTGTGAAATCAAAACCCTGGAGACAACGGGAAGCACGTAAAGAACAGGGAGAAATGGAACAAGGCGAGGGTTCTCGTTCACAGCCATCTGATGAAATATGGTCCAAACTTGTGCCATCAGACAACAAGTTTTCAGAAGTTGAATTGTGGTTAAATGAGGCGGAGATAAATTCAGAGTTCAAAATCTCTTCGTTCGAAAAACA...

CDS

Download CDS FASTA

1395 bp · TkA08G258250|TK1151|CDS

ATGGAACAAGGCGAGGGTTCTCGTTCACAGCCATCTGATGAAATATGGTCCAAACTTGTGCCATCAGACAACAAGTTTTCAGAAGTTGAATTGTGGTTAAATGAGGCGGAGATAAATTCAGAGTTCAAAATCTCTTCGTTCGAAAAACAAAAATGGTGTAAAATTACAAGAAATACGGATCTTTCTTCTGCAACATTGCAAAATAAGAGTTTAAATGTGATTTTTGTGGATGGAACTGATGTTCCAACAGAAGATACGAT...

Protein

Download Protein FASTA

464 aa · TkA08G258250|TK1151|PROTEIN

MEQGEGSRSQPSDEIWSKLVPSDNKFSEVELWLNEAEINSEFKISSFEKQKWCKITRNTDLSSATLQNKSLNVIFVDGTDVPTEDTIMIRCGSEIILGPTSEGYLSYRFKVMPVDEPSKKVIKISLDSDHAKCSICLNIWHDVVTVAPCLHNFCNGCFSEWLKRSQAKHATVLCPHCRSVVQFVGRNHFLHSIEEEILQSDSSLRRSDEELAVLNTYSLIKSPLVINNGKKPRGKRSRAIPEEDSSSSSTNLACAQCGTE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G258250`
TK1151 ID	TkA08G258250
OH-1004 ID	LXL04_033459
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.600
Protein coverage (%)	TK1151 97.629 / OH-1004 63.713 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G258250`
Location	Chr08:67337069-67340530 (+)
Description	Similar to CPN20: 20 kDa chaperonin, chloroplastic
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_033459` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006457 protein folding Biological Process GO:0009409 response to cold Biological Process GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process GO:0051290 protein heterotetramerization Biological Process GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0009507 chloroplast Cellular Component GO:0009535 chloroplast thylakoid membrane Cellular Component GO:0009536 plastid Cellular Component GO:0009570 chloroplast stroma Cellular Component GO:0009579 thylakoid Cellular Component GO:0009941 chloroplast envelope Cellular Component
KEGG gene cross-reference	ath:AT5G20720 tex:Teth514_0512 tpd:Teth39_1722 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.528

Rank 1 · TkA08G258250 · TK1151

Nucleus0.510

Rank 2 · TkA08G258250 · TK1151

Cell membrane0.077

Rank 3 · TkA08G258250 · TK1151

Mitochondrion0.061

Rank 4 · TkA08G258250 · TK1151

Endoplasmic reticulum0.052

Rank 5 · TkA08G258250 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00498FHA53-98 aa

PF17979zf-CRD130-159 aa

PF13920zf-C3HC4_3131-182 aa

PF13639zf-RING_2132-178 aa

PF13923zf-C3HC4_2132-177 aa

PF14634zf-RING_5132-178 aa

PF00097zf-C3HC4133-177 aa

PF13445zf-RING_UBOX133-175 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G258250	`PF00498`	FHA	53	98	0.015	16.4
TkA08G258250	`PF17979`	zf-CRD	130	159	4.6e-52	177.2
TkA08G258250	`PF13920`	zf-C3HC4_3	131	182	0.00042	20.8
TkA08G258250	`PF13639`	zf-RING_2	132	178	5.8e-07	30.4
TkA08G258250	`PF13923`	zf-C3HC4_2	132	177	4.5e-06	27.1
TkA08G258250	`PF14634`	zf-RING_5	132	178	0.044	14.5
TkA08G258250	`PF00097`	zf-C3HC4	133	177	1.1e-07	32.2
TkA08G258250	`PF13445`	zf-RING_UBOX	133	175	8.6e-05	23.2
TkA08G258250	`PF24921`	RING_XB3-XBAT31	133	181	0.00022	21.9
TkA08G258250	`PF15227`	zf-C3HC4_4	133	177	0.0018	19.0
TkA08G258250	`PF12861`	zf-ANAPC11	146	183	0.0099	16.6
TkA08G258250	`PF15227`	zf-C3HC4_4	246	257	0.0018	19.0
TkA08G258250	`PF14634`	zf-RING_5	253	278	0.044	14.5
TkA08G258250	`PF17979`	zf-CRD	254	417	4.6e-52	177.2
TkA08G258250	`PF00097`	zf-C3HC4	254	278	1.1e-07	32.2
TkA08G258250	`PF13639`	zf-RING_2	254	276	5.8e-07	30.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card