TkA08G253820 | RubberDandelionOmics

Gene overview

TkA08G253820

Reference: TK1151 Chr: Chr08 Coordinates: 66250785-66254995 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2574 bp · TkA08G253820|TK1151|cDNA

GCTGAAGTTGAAGAGGATCTGGTGGTAAAGAATGAAATATTTGGCCTAAATAGCAAAGAAGGAAAGTACATGTACCTAAATTGTCATCCATCAGAAAAACTCGAGCCTAGGCAATTGCGGCCAGACAGGCAGCGGAGATAACATATTGATGCTTCTTAAAACGCGACGTCGCAGTAACCTACCATAGAATTTTAAACCGCCGGCGGCAAAGACGACGGTGACGGAGACGCACCTCCGTGTATTACTTTATAGTTGCAGGA...

CDS

Download CDS FASTA

2001 bp · TkA08G253820|TK1151|CDS

ATGATCAGAAAGCCAATTGCGCACAAAGACAAGTACTCAAACAGATACGAGATCTCACAGAATCACTCCAATGAAGGCACATCTGCAAGAACAAGGCCTTATAGCTTTGATGAGATAATGCATAGAAGGAAAACCAAAAAGCTATCTGGAAATGTTGAAGGTCAACAACGACTTGCCTCAGAGATAGTCTGTAATAAAGAAGCTGAAAGTGTCTCTGGTCGTGTAGAATCTGATAGACACAGACACAGGGATGGCTATGG...

Protein

Download Protein FASTA

666 aa · TkA08G253820|TK1151|PROTEIN

MIRKPIAHKDKYSNRYEISQNHSNEGTSARTRPYSFDEIMHRRKTKKLSGNVEGQQRLASEIVCNKEAESVSGRVESDRHRHRDGYGVSEHHASNDPSKQTSRTKESDNTQRRSKLDSDNPKDRRKERDSVHEKRKNQDRLTDDFHNEHSKRHVKDSSVKERDRNGYNEKSRDHESRKRHEREKRRSNSPSQRGNKQRLYDAREHEDKKRLSSLSLSNNDSINNKSKRHDTSGLSRLGGYSPRKRRNESTIKTPSPIDSP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G253820`
TK1151 ID	TkA08G253820
OH-1004 ID	LXL04_033360
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.500
Protein coverage (%)	TK1151 99.700 / OH-1004 89.960 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G253820`
Location	Chr08:66250785-66254995 (+)
Description	Similar to U2af50: Splicing factor U2AF 50 kDa subunit
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_033360` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000245 spliceosomal complex assembly Biological Process GO:0000381 regulation of alternative mRNA splicing, via spliceosome Biological Process GO:0000389 mRNA 3'-splice site recognition Biological Process GO:0000398 mRNA splicing, via spliceosome Biological Process GO:0006397 mRNA processing Biological Process GO:0007281 germ cell development Biological Process GO:0008380 RNA splicing Biological Process GO:0010172 embryonic body morphogenesis Biological Process GO:0031397 negative regulation of protein ubiquitination Biological Process GO:0033120 positive regulation of RNA splicing Biological Process GO:0046833 positive regulation of RNA export from nucleus Biological Process GO:0048024 regulation of mRNA splicing, via spliceosome Biological Process
KEGG gene cross-reference	cbr:CBG_15152 cel:CELE_Y92C3B.2 dme:Dmel_CG9998 hsa:11338 mmu:22185 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.970

Rank 1 · TkA08G253820 · TK1151

Cytoplasm0.084

Rank 2 · TkA08G253820 · TK1151

Cell membrane0.021

Rank 3 · TkA08G253820 · TK1151

Endoplasmic reticulum0.010

Rank 4 · TkA08G253820 · TK1151

Plastid0.008

Rank 5 · TkA08G253820 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076RRM_1323-397 aa

PF16842RRM_occluded366-403 aa

PF24475RBD_DEAH11371-400 aa

PF18444RRM_9377-401 aa

PF00076RRM_1435-502 aa

PF16842RRM_occluded470-505 aa

PF18444RRM_9478-506 aa

PF24475RBD_DEAH11486-506 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G253820	`PF00076`	RRM_1	323	397	6e-17	62.0
TkA08G253820	`PF16842`	RRM_occluded	366	403	0.028	15.0
TkA08G253820	`PF24475`	RBD_DEAH11	371	400	0.019	15.8
TkA08G253820	`PF18444`	RRM_9	377	401	0.0015	19.0
TkA08G253820	`PF00076`	RRM_1	435	502	6e-17	62.0
TkA08G253820	`PF16842`	RRM_occluded	470	505	0.028	15.0
TkA08G253820	`PF18444`	RRM_9	478	506	0.0015	19.0
TkA08G253820	`PF24475`	RBD_DEAH11	486	506	0.019	15.8
TkA08G253820	`PF29326`	RRM_MUD2_C	537	584	3.1e-05	24.7
TkA08G253820	`PF28977`	DUF8489	547	656	0.00022	22.2
TkA08G253820	`PF00076`	RRM_1	564	584	6e-17	62.0
TkA08G253820	`PF00076`	RRM_1	623	652	6e-17	62.0
TkA08G253820	`PF29326`	RRM_MUD2_C	623	661	3.1e-05	24.7
TkA08G253820	`PF16842`	RRM_occluded	625	653	0.028	15.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card