TkA08G242340 | RubberDandelionOmics

Gene overview

TkA08G242340

Reference: TK1151 Chr: Chr08 Coordinates: 63249489-63255524 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4083 bp · TkA08G242340|TK1151|cDNA

TATGAAATAAAGTGCAAGAAGACGCCGTGATCATACGGTTTCCATCTATATACAAATATATCCACGAATGAAGGGTCAAGACTTCTTCAATTAACACAAAATCTTTAATAAATGTTCGTCTTTAGATCGGTCATGGGGATTTGATGAACCCATCTCCCACGTGTTCATCACCCCCTCTATATCTTGCTCTTCCTGCACTCAACTCACTCCTCCCAAGCTTCACAATCACAGAATTTCTCTACATTTCCATTATTTTCCAA...

CDS

Download CDS FASTA

3567 bp · TkA08G242340|TK1151|CDS

ATGGATTCTCTGCGTGTGCTCAATTGTTACTCTGCCACCAAGAATCCATCCCCTTTAGAAAACCAGTCCGCCAGGGAATTCAGATTCCTCCATCACCACAACCGGCAAAGAACTTTTCGTGTTGTGGGTTTTTTGAAGCCAAGATTAAGTCCTCATCCCGGCCATTATTTGCGATTTCAACAACAGTCTTCTCCCGTTGTATGTGCCGTATCCACCCAAACCAGAGACGAAGAGAAGGGGGAAACAGAAATGAAGTCAAA...

Protein

Download Protein FASTA

1188 aa · TkA08G242340|TK1151|PROTEIN

MDSLRVLNCYSATKNPSPLENQSAREFRFLHHHNRQRTFRVVGFLKPRLSPHPGHYLRFQQQSSPVVCAVSTQTRDEEKGETEMKSKTSHGKVQLTLRLDHQVKFGEHVAVMGSTKEFGSWKKKKQLNWTETGWVCDIECKGNETHEFKFIVEQMDKSMIWEGGDNRVLKLPKSGSFEMVCHWNMTNEPINLLPVDGKEYEVEVESVDEIEDNNSSTSTTSPFVEKWKGKEASFMRSNEHGDREGQRHWDTSGLQGVALK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G242340`
TK1151 ID	TkA08G242340
OH-1004 ID	LXL04_033224
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G242340

Location Chr08:63249489-63255524 (+)

Description Similar to GWD3: Phosphoglucan, water dikinase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g26570`	Mediates the incorporation of phosphate into starch-like phospho-alpha-glucan, mostly at the C-3 position of glucose units.	A novel isoform of glucan, water dikinase phosphorylates pre-phosphorylated alpha-glucans and is involved in starch degradation in Arabidopsis.2005 · DOI: 10.1111/j.1365-313x.2004.02322.x
`At4g24450`	Mediates the incorporation of phosphate into alpha-glucan, mostly at the C-6 position of glucose units.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0297500`	Mediates the incorporation of phosphate into starch-like phospho-alpha-glucan, mostly at the C-3 position of glucose units.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033224 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005982 starch metabolic process Biological Process

GO:0005983 starch catabolic process Biological Process

GO:0009610 response to symbiotic fungus Biological Process

GO:0009631 cold acclimation Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0004673 protein histidine kinase activity Molecular Function

KEGG gene cross-reference

ag:CAA70725

ath:AT1G10760

ath:AT5G26570

dosa:Os12g0297500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.963

Rank 1 · TkA08G242340 · TK1151

Cytoplasm0.052

Rank 2 · TkA08G242340 · TK1151

Mitochondrion0.044

Rank 3 · TkA08G242340 · TK1151

Peroxisome0.038

Rank 4 · TkA08G242340 · TK1151

Nucleus0.029

Rank 5 · TkA08G242340 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00686CBM_2093-176 aa

PF16561AMPK1_CBM106-154 aa

PF21101YqgU175-239 aa

PF31155PWD_link250-448 aa

PF01326PPDK_N374-399 aa

PF03978Borrelia_REV432-484 aa

PF22973GWD1_pHisD709-817 aa

PF01326PPDK_N891-1186 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G242340	`PF00686`	CBM_20	93	176	8.2e-14	51.9
TkA08G242340	`PF16561`	AMPK1_CBM	106	154	0.052	14.5
TkA08G242340	`PF21101`	YqgU	175	239	0.12	12.4
TkA08G242340	`PF31155`	PWD_link	250	448	3e-102	341.3
TkA08G242340	`PF01326`	PPDK_N	374	399	5.5e-36	125.2
TkA08G242340	`PF03978`	Borrelia_REV	432	484	0.063	13.9
TkA08G242340	`PF22973`	GWD1_pHisD	709	817	2.3e-31	108.5
TkA08G242340	`PF01326`	PPDK_N	891	1186	5.5e-36	125.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6ZY51`	Arabidopsis thaliana	sp\|Q6ZY51\|PWD_ARATH Phosphoglucan, water dikinase, chloroplastic	64.000%	Swiss-Prot	High
`Q9STV0`	Arabidopsis thaliana	sp\|Q9STV0\|GWD2_ARATH Alpha-glucan water dikinase 2	24.400%	Swiss-Prot	Low
`Q2QTC2`	Oryza sativa subsp. japonica	sp\|Q2QTC2\|PWD_ORYSJ Phosphoglucan, water dikinase, chloroplastic	61.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card