LXL04_033224 | RubberDandelionOmics

Gene overview

LXL04_033224

Reference: OH-1004 Chr: Chr07 Coordinates: 38711608-38717102 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3606 bp · LXL04_033224|LXL04_033224|OH1004|cDNA

ATGGATTCTCTGCGTGTGCTCAATTGTTACTCTGCCACCAAGAATCCATCCCCTTTAGAAAACCAGTCCGCCAGGGAATTCAGATTCCTCCATCACCACAACCGGCAAAGAACTTTTCGTGTTGTGGGTTTTTTGAAGCCAAGATTAAGTCCTCATCCCGGCCATTATTTGCGATTTCAACAACAGTCTTCTCCCGTTGTATGTGCCGTATCCACCCAAACCAGAGACGAAGAGAAGGGGGAAACAGAAATGAAGTCAAA...

CDS

Download CDS FASTA

3606 bp · LXL04_033224|LXL04_033224|OH1004|CDS

ATGGATTCTCTGCGTGTGCTCAATTGTTACTCTGCCACCAAGAATCCATCCCCTTTAGAAAACCAGTCCGCCAGGGAATTCAGATTCCTCCATCACCACAACCGGCAAAGAACTTTTCGTGTTGTGGGTTTTTTGAAGCCAAGATTAAGTCCTCATCCCGGCCATTATTTGCGATTTCAACAACAGTCTTCTCCCGTTGTATGTGCCGTATCCACCCAAACCAGAGACGAAGAGAAGGGGGAAACAGAAATGAAGTCAAA...

Protein

Download Protein FASTA

1201 aa · LXL04_033224|LXL04_033224|OH1004|PROTEIN

MDSLRVLNCYSATKNPSPLENQSAREFRFLHHHNRQRTFRVVGFLKPRLSPHPGHYLRFQQQSSPVVCAVSTQTRDEEKGETEMKSKTSHGKVQLTLRLDHQVKFGEHVAVMGSTKEFGSWKKKKQLNWTETGWVCDIECKGNETHEFKFIVEQMDKSMIWEGGDNRVLKLPKSGSFEMVCHWTMTNEPINLLPVDGKEYEVEVESVDEIEDNNSSTSTTSPFVEKWKGKEASFMRSNEHGDRERERHWDTSGLQGVALK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033224`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033224

Location Chr07:38711608-38717102 (+)

Description Similar to GWD3: Phosphoglucan, water dikinase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g26570`	Mediates the incorporation of phosphate into starch-like phospho-alpha-glucan, mostly at the C-3 position of glucose units.	A novel isoform of glucan, water dikinase phosphorylates pre-phosphorylated alpha-glucans and is involved in starch degradation in Arabidopsis.2005 · DOI: 10.1111/j.1365-313x.2004.02322.x
`At1g10760`	Mediates the incorporation of phosphate into starch-like alpha-glucan, mostly at the C-6 position of glucose units.	The Arabidopsis sex1 mutant is defective in the R1 protein, a general regulator of starch degradation in plants, and not in the chloroplast hexose transporter.2001 · DOI: 10.1105/tpc.010091

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0297500`	Mediates the incorporation of phosphate into starch-like phospho-alpha-glucan, mostly at the C-3 position of glucose units.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033224 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005982 starch metabolic process Biological Process

GO:0005983 starch catabolic process Biological Process

GO:0009610 response to symbiotic fungus Biological Process

GO:0009631 cold acclimation Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0004673 protein histidine kinase activity Molecular Function

KEGG gene cross-reference

ag:CAA70725

ath:AT1G10760

ath:AT5G26570

dosa:Os12g0297500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.964

Rank 1 · LXL04_033224 · OH-1004

Cytoplasm0.049

Rank 2 · LXL04_033224 · OH-1004

Mitochondrion0.044

Rank 3 · LXL04_033224 · OH-1004

Peroxisome0.034

Rank 4 · LXL04_033224 · OH-1004

Nucleus0.027

Rank 5 · LXL04_033224 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00686.26CBM_2093-176 aa

PF31155.1PWD_link250-448 aa

PF22973.3GWD1_pHisD709-830 aa

PF01326.25PPDK_N904-1199 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033224	`PF00686.26`	CBM_20	93	176	8.2e-14	51.9
LXL04_033224	`PF31155.1`	PWD_link	250	448	2.3e-102	341.7
LXL04_033224	`PF22973.3`	GWD1_pHisD	709	830	2.8e-28	98.6
LXL04_033224	`PF01326.25`	PPDK_N	904	1199	5.6e-36	125.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6ZY51`	Arabidopsis thaliana	Phosphoglucan, water dikinase, chloroplastic	62.200%	Swiss-Prot	strong database homology
`Q9SAC6`	Arabidopsis thaliana	Alpha-glucan water dikinase 1, chloroplastic	25.705%	Swiss-Prot	weak database homology
`Q2QTC2`	Oryza sativa subsp. japonica	Phosphoglucan, water dikinase, chloroplastic	60.256%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card