TkA08G242090 | RubberDandelionOmics

Gene overview

TkA08G242090

Reference: TK1151 Chr: Chr08 Coordinates: 63170454-63175520 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3086 bp · TkA08G242090|TK1151|cDNA

GTTCGAACAAAAAGAGGGAAGAATATGAGAAGTAGGTCAAAGTCAAATAGTAATCGAACGATGCTTACCGGACGTGAAAGTTTGATCAGATTAATCGGCAAGCGCCGCCGATTCCTCCCAAATCGTCAATCCCTTCTGTCAGACCCCATTCAGATATCTTCGAGTCTTGTGAAAGTTGAAAATGGAGCAGAAGATCTGTTAGAGGAACGTAATGACAATTTGGCGGGGACTTCGGGTTCCGATAAGGTTATTTGTCCAGT...

CDS

Download CDS FASTA

2871 bp · TkA08G242090|TK1151|CDS

ATGAGAAGTAGGTCAAAGTCAAATAGTAATCGAACGATGCTTACCGGACGTGAAAGTTTGATCAGATTAATCGGCAAGCGCCGCCGATTCCTCCCAAATCGTCAATCCCTTCTGTCAGACCCCATTCAGATATCTTCGAGTCTTGTGAAAGTTGAAAATGGAGCAGAAGATCTGTTAGAGGAACGTAATGACAATTTGGCGGGGACTTCGGGTTCCGATAAGGTTATTTGTCCAGTTTGCGGGAATAAGGTTCGAGGCGA...

Protein

Download Protein FASTA

956 aa · TkA08G242090|TK1151|PROTEIN

MRSRSKSNSNRTMLTGRESLIRLIGKRRRFLPNRQSLLSDPIQISSSLVKVENGAEDLLEERNDNLAGTSGSDKVICPVCGNKVRGEDYMINSHLDACLTRGTKRKLSQQTLLQFNFSPRSKVRTCLTYSDDTKSNITSHDKDTTDLIGIDTEVTDSITYESSSSPDVNIDPSAEILVNDDKTIASSGSIITNGEIGNCATSVSEIEASENDSAYTDDDISGTFLATFIVGRKFGDEGELHTGTNISLFRDPENVKDPNA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G242090`
TK1151 ID	TkA08G242090
OH-1004 ID	LXL04_033220
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.400
Protein coverage (%)	TK1151 100.000 / OH-1004 97.751 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G242090

Location Chr08:63170454-63175520 (-)

Description Similar to FAN1: Fanconi-associated nuclease 1 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g48360`	Nuclease required for the repair of DNA interstrand cross-links (ICLs).	The nuclease FAN1 is involved in DNA crosslink repair in Arabidopsis thaliana independently of the nuclease MUS81.2015 · DOI: 10.1093/nar/gkv208

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0171800`	Nuclease required for the repair of DNA interstrand cross-links (ICL).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033220 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006281 DNA repair Biological Process

GO:0006289 nucleotide-excision repair Biological Process

GO:0007129 homologous chromosome pairing at meiosis Biological Process

GO:0036297 interstrand cross-link repair Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005929 cilium Cellular Component

GO:0045171 intercellular bridge Cellular Component

GO:0000287 magnesium ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G48360

dosa:Os06g0171800

dre:565458

hsa:22909

mmu:330554

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.864

Rank 1 · TkA08G242090 · TK1151

Cytoplasm0.160

Rank 2 · TkA08G242090 · TK1151

Cell membrane0.033

Rank 3 · TkA08G242090 · TK1151

Plastid0.029

Rank 4 · TkA08G242090 · TK1151

Endoplasmic reticulum0.020

Rank 5 · TkA08G242090 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15926RNF22074-104 aa

PF23730CILP_8th136-174 aa

PF08797HIRAN227-325 aa

PF21053BFA1_C299-325 aa

PF21315FAN1_HTH357-436 aa

PF21053BFA1_C358-414 aa

PF08774VRR_NUC393-415 aa

PF21315FAN1_HTH486-504 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G242090	`PF15926`	RNF220	74	104	0.1	13.0
TkA08G242090	`PF23730`	CILP_8th	136	174	0.35	11.6
TkA08G242090	`PF08797`	HIRAN	227	325	2e-16	60.3
TkA08G242090	`PF21053`	BFA1_C	299	325	0.098	13.3
TkA08G242090	`PF21315`	FAN1_HTH	357	436	7.2e-16	58.6
TkA08G242090	`PF21053`	BFA1_C	358	414	0.098	13.3
TkA08G242090	`PF08774`	VRR_NUC	393	415	4.9e-34	117.5
TkA08G242090	`PF21315`	FAN1_HTH	486	504	7.2e-16	58.6
TkA08G242090	`PF21053`	BFA1_C	573	622	0.098	13.3
TkA08G242090	`PF21170`	FAN1_TPR	615	708	1.4e-12	48.5
TkA08G242090	`PF08774`	VRR_NUC	839	951	4.9e-34	117.5
TkA08G242090	`PF23730`	CILP_8th	858	892	0.35	11.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5XVJ4`	Arabidopsis thaliana	sp\|Q5XVJ4\|FAN1_ARATH Fanconi-associated nuclease 1 homolog	53.000%	Swiss-Prot	High
`Q5SNL7`	Oryza sativa subsp. japonica	sp\|Q5SNL7\|FAN1_ORYSJ Fanconi-associated nuclease 1 homolog	47.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card