LXL04_033220 | RubberDandelionOmics

Gene overview

LXL04_033220

Reference: OH-1004 Chr: Chr07 Coordinates: 38528620-38533883 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2937 bp · LXL04_033220|LXL04_033220|OH1004|cDNA

ATGTTGGCTACCAATTATATTGATTCGGTTGGTAACGAATTGGTTGGTTCTCCACGAGGGAAGAATATGAGAAGTAGGTCAAAGTCAAATAGTAATCGAACGATGCTTACCGGACGTGAAAGTTTGATCACATTAATCGGCAAGCGCCGCCGATTCCTCCCAAATCGTCAATCCCTTCTGTCAGACCCCATTCAGATATCTTCGAGTCTTGTGAAAGTTGAAAATGGAGCAGAAGATCTGTTAGAGGAACGTAATGGCAA...

CDS

Download CDS FASTA

2937 bp · LXL04_033220|LXL04_033220|OH1004|CDS

ATGTTGGCTACCAATTATATTGATTCGGTTGGTAACGAATTGGTTGGTTCTCCACGAGGGAAGAATATGAGAAGTAGGTCAAAGTCAAATAGTAATCGAACGATGCTTACCGGACGTGAAAGTTTGATCACATTAATCGGCAAGCGCCGCCGATTCCTCCCAAATCGTCAATCCCTTCTGTCAGACCCCATTCAGATATCTTCGAGTCTTGTGAAAGTTGAAAATGGAGCAGAAGATCTGTTAGAGGAACGTAATGGCAA...

Protein

Download Protein FASTA

978 aa · LXL04_033220|LXL04_033220|OH1004|PROTEIN

MLATNYIDSVGNELVGSPRGKNMRSRSKSNSNRTMLTGRESLITLIGKRRRFLPNRQSLLSDPIQISSSLVKVENGAEDLLEERNGNLAGTSGSDKVICPVCGNKVRGEDYMINSHLDACLTRGTKRKLSQQTLLQFNFSPRSKVRTCLTYSVDTKSNITSHDKDTTDLIGIDTEVTDSITYESSSSPDVNIDPSAEILVNDDKTIASSGSIITNGEIGNCATSVSEIEASENDSAYTDDDISGTFLATFIVGRKFGDEG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033220`
TK1151 ID	TkA08G242090
OH-1004 ID	LXL04_033220
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.400
Protein coverage (%)	TK1151 100.000 / OH-1004 97.751 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033220

Location Chr07:38528620-38533883 (-)

Description Similar to FAN1: Fanconi-associated nuclease 1 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g48360`	Nuclease required for the repair of DNA interstrand cross-links (ICLs).	The nuclease FAN1 is involved in DNA crosslink repair in Arabidopsis thaliana independently of the nuclease MUS81.2015 · DOI: 10.1093/nar/gkv208

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0171800`	Nuclease required for the repair of DNA interstrand cross-links (ICL).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033220 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006281 DNA repair Biological Process

GO:0006289 nucleotide-excision repair Biological Process

GO:0007129 homologous chromosome pairing at meiosis Biological Process

GO:0036297 interstrand cross-link repair Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005929 cilium Cellular Component

GO:0045171 intercellular bridge Cellular Component

GO:0000287 magnesium ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G48360

dosa:Os06g0171800

dre:565458

hsa:22909

mmu:330554

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.873

Rank 1 · LXL04_033220 · OH-1004

Cytoplasm0.149

Rank 2 · LXL04_033220 · OH-1004

Cell membrane0.033

Rank 3 · LXL04_033220 · OH-1004

Plastid0.030

Rank 4 · LXL04_033220 · OH-1004

Endoplasmic reticulum0.020

Rank 5 · LXL04_033220 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08797.17HIRAN249-347 aa

PF21315.4FAN1_HTH379-458 aa

PF21170.5FAN1_TPR637-730 aa

PF08774.18VRR_NUC861-973 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033220	`PF08797.17`	HIRAN	249	347	2e-16	60.3
LXL04_033220	`PF21315.4`	FAN1_HTH	379	458	1.2e-15	57.9
LXL04_033220	`PF21170.5`	FAN1_TPR	637	730	1.5e-12	48.5
LXL04_033220	`PF08774.18`	VRR_NUC	861	973	5.2e-34	117.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5XVJ4`	Arabidopsis thaliana	Fanconi-associated nuclease 1 homolog	53.066%	Swiss-Prot	strong database homology
`Q5SNL7`	Oryza sativa subsp. japonica	Fanconi-associated nuclease 1 homolog	47.500%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card