TkA08G234940 | RubberDandelionOmics

Gene overview

TkA08G234940

Reference: TK1151 Chr: Chr08 Coordinates: 61250296-61251687 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

639 bp · TkA08G234940|TK1151|cDNA

TTACTCTTATCGTCCATATATATTCTGTAAAAGCGAAAACCTGAATTTCCTAAGAAATTCTGAGAAATTTATTCAAGCAAACAAAGATGCCTTTGAAAATAGCCGACGCGACCTTATCGACCTTCAACGCCGTTTTCGAGAAATTCAAATCCGAAGCACCAAACAACAAAAGCAATTTCATATTGTTCTTGGCTGATATCGAACCTTCCACTAATCTCAGTTGGTGCCCTGATTGTGTGCGAGCTGAACCTGTTATATAC...

CDS

Download CDS FASTA

402 bp · TkA08G234940|TK1151|CDS

ATGCCTTTGAAAATAGCCGACGCGACCTTATCGACCTTCAACGCCGTTTTCGAGAAATTCAAATCCGAAGCACCAAACAACAAAAGCAATTTCATATTGTTCTTGGCTGATATCGAACCTTCCACTAATCTCAGTTGGTGCCCTGATTGTGTGCGAGCTGAACCTGTTATATACAAAAAACTTGAATCATCAAGTGATGACGTGGCACTCCTAAGGGCTTACGTGGGAGACAGGCCCACGTGGAGGAATCCACATCACCC...

Protein

Download Protein FASTA

133 aa · TkA08G234940|TK1151|PROTEIN

MPLKIADATLSTFNAVFEKFKSEAPNNKSNFILFLADIEPSTNLSWCPDCVRAEPVIYKKLESSSDDVALLRAYVGDRPTWRNPHHPLRVDSKFKLKGVPTLVVWENGEVKGRLEDHEAHIERKIDELLNANK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G234940`
TK1151 ID	TkA08G234940
OH-1004 ID	LXL04_033147
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G234940

Location Chr08:61250296-61251687 (-)

Description Similar to At5g42850: Thioredoxin-like protein Clot

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g42850`	Probable thiol-disulfide oxidoreductase that may participate in various redox reactions.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0320000`	Probable thiol-disulfide oxidoreductase that may participate in various redox reactions.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033147 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0033209 tumor necrosis factor-mediated signaling pathway Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009536 plastid Cellular Component

GO:0070062 extracellular exosome Cellular Component

GO:0004601 peroxidase activity Molecular Function

GO:0047134 protein-disulfide reductase [NAD(P)H] activity Molecular Function

KEGG gene cross-reference

ath:AT5G42850

dosa:Os06g0320000

hsa:84817

mmu:52700

pon:100171754

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.756

Rank 1 · TkA08G234940 · TK1151

Nucleus0.395

Rank 2 · TkA08G234940 · TK1151

Mitochondrion0.127

Rank 3 · TkA08G234940 · TK1151

Peroxisome0.066

Rank 4 · TkA08G234940 · TK1151

Cell membrane0.043

Rank 5 · TkA08G234940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06110TXD17-like_Trx13-129 aa

PF14595Thioredoxin_913-32 aa

PF13098Thioredoxin_231-111 aa

PF00085Thioredoxin45-119 aa

PF14595Thioredoxin_945-59 aa

PF20207PedC-like47-132 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G234940	`PF06110`	TXD17-like_Trx	13	129	1.2e-32	112.7
TkA08G234940	`PF14595`	Thioredoxin_9	13	32	0.23	12.1
TkA08G234940	`PF13098`	Thioredoxin_2	31	111	0.18	12.8
TkA08G234940	`PF00085`	Thioredoxin	45	119	0.00051	20.7
TkA08G234940	`PF14595`	Thioredoxin_9	45	59	0.23	12.1
TkA08G234940	`PF20207`	PedC-like	47	132	0.00029	21.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FMN4`	Arabidopsis thaliana	sp\|Q9FMN4\|TCLOT_ARATH Thioredoxin-like protein Clot	61.500%	Swiss-Prot	High
`Q5Z9Z3`	Oryza sativa subsp. japonica	sp\|Q5Z9Z3\|OCLOT_ORYSJ Thioredoxin-like protein Clot	49.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card