Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2249 bp · TkA08G229750|TK1151|cDNA
TCAGCCGTCGGATCCTAATCCAACGGCTGAAATTCAATAATTTCAATCTTATATATTAACGTGGACTCCTTCGATTTCTCAACTGTCCTCGCTGATACCACAAAGTAAACACAAACAGATCCCGGATTCCGCCGTCAAACGCCATCGTTTACTCCTAACGATGGCGTCGGTAGCTCTCACCGCCTCCGTCAACCTAGGGTTTAGGTCATTCGCCGACTCCAAGCTCCGTCTATCGTCCAGAAAATCTCCACCGTTAAATC...
1686 bp · TkA08G229750|TK1151|CDS
ATGGCGTCGGTAGCTCTCACCGCCTCCGTCAACCTAGGGTTTAGGTCATTCGCCGACTCCAAGCTCCGTCTATCGTCCAGAAAATCTCCACCGTTAAATCTCAACAGATCAAACTCTCAACACCTCCTCCGGTCATCTTCTTCATACACATCAACTTCCCGATTACCACTACTCAGCCTGAAATCACCCAAGAGAAGCTTGAATTTCACTGTAAAAGCCTCTTCGGCTGTAGTTCCGGCTCAACAGGATCCTGCTCCTGC...
Protein
Download Protein FASTA561 aa · TkA08G229750|TK1151|PROTEIN
MASVALTASVNLGFRSFADSKLRLSSRKSPPLNLNRSNSQHLLRSSSSYTSTSRLPLLSLKSPKRSLNFTVKASSAVVPAQQDPAPAPVPWQGAAMKPLLAAIATGVILWFVPVPAGVSKNAWQLLAIFLATIVGIITQPLPLGAVALMGLGACVLTKTLTFAAAFSAFGDPIPWLIALAFFFARGFIKTGLGNRIAYQFVSLFGSSSLGLGYSLVFSEALLAPAIPSVSARAGGIFLPLVKSLCVACGSNAGDGTEHKL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G229750 |
|---|---|
| TK1151 ID | TkA08G229750 |
| OH-1004 ID | LXL04_017148 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 47.300 |
| Protein coverage (%) | TK1151 95.009 / OH-1004 79.666Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G229750 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr08:59897275-59899697 (-) | |||||||||
| Description | Similar to DIT2-1: Dicarboxylate transporter 2.1, chloroplastic | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0009624 response to nematode Biological Process GO:0015729 oxaloacetate transport Biological Process GO:0015742 alpha-ketoglutarate transport Biological Process GO:0015743 malate transport Biological Process GO:0015813 L-glutamate transmembrane transport Biological Process GO:0019676 ammonia assimilation cycle Biological Process GO:0071423 malate transmembrane transport Biological Process GO:0009507 chloroplast Cellular Component GO:0009534 chloroplast thylakoid Cellular Component GO:0009536 plastid Cellular Component GO:0009706 chloroplast inner membrane Cellular Component GO:0009941 chloroplast envelope Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT5G12860 ath:AT5G64280 ath:AT5G64290 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF10565NMDAR2_C27-76 aaPF00939Na_sulph_symp98-561 aaPF03600CitMHS101-116 aaPF10841DUF2644102-135 aaPF03600CitMHS134-456 aaPF10841DUF2644255-271 aaPF10841DUF2644383-421 aaPF24752DUF7697471-500 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA08G229750 | PF10565 | NMDAR2_C | 27 | 76 | 0.5 | 10.0 |
| TkA08G229750 | PF00939 | Na_sulph_symp | 98 | 561 | 1.9e-147 | 492.8 |
| TkA08G229750 | PF03600 | CitMHS | 101 | 116 | 8.5e-19 | 68.5 |
| TkA08G229750 | PF10841 | DUF2644 | 102 | 135 | 4.2 | 8.4 |
| TkA08G229750 | PF03600 | CitMHS | 134 | 456 | 8.5e-19 | 68.5 |
| TkA08G229750 | PF10841 | DUF2644 | 255 | 271 | 4.2 | 8.4 |
| TkA08G229750 | PF10841 | DUF2644 | 383 | 421 | 4.2 | 8.4 |
| TkA08G229750 | PF24752 | DUF7697 | 471 | 500 | 0.49 | 11.1 |
| TkA08G229750 | PF03600 | CitMHS | 478 | 546 | 8.5e-19 | 68.5 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.