LXL04_017148 | RubberDandelionOmics

Gene overview

LXL04_017148

Reference: OH-1004 Chr: Chr03 Coordinates: 142014256-142018639 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1980 bp · LXL04_017148|LXL04_017148|OH1004|cDNA

ATGATTTTGCTTGAAATGTTATTTGAAGAGAATGATTTTGCTTGCTATGATCTTGCTTGGAATTTTAACATATTCCCGTGCAACACGCGGATATTCAGCTcgtataaaaatataaaaagagcCGCATATTTTTACCCGCAAAGGATTCATATTCCTGGACGCTGTCAGCGCAAAACAAAATCTGTGGCGGTCCTCCTGGCGGACTCATCTTCGTGCTCTCCGCCCTGCACCACCATTTCTGCGAATCTCAAACTCTCCTC...

CDS

Download CDS FASTA

1980 bp · LXL04_017148|LXL04_017148|OH1004|CDS

ATGATTTTGCTTGAAATGTTATTTGAAGAGAATGATTTTGCTTGCTATGATCTTGCTTGGAATTTTAACATATTCCCGTGCAACACGCGGATATTCAGCTCGTATAAAAATATAAAAAGAGCCGCATATTTTTACCCGCAAAGGATTCATATTCCTGGACGCTGTCAGCGCAAAACAAAATCTGTGGCGGTCCTCCTGGCGGACTCATCTTCGTGCTCTCCGCCCTGCACCACCATTTCTGCGAATCTCAAACTCTCCTC...

Protein

Download Protein FASTA

659 aa · LXL04_017148|LXL04_017148|OH1004|PROTEIN

MILLEMLFEENDFACYDLAWNFNIFPCNTRIFSSYKNIKRAAYFYPQRIHIPGRCQRKTKSVAVLLADSSSCSPPCTTISANLKLSSSTLAMEASALFSTAFSAPSLHLRSRIVSKSRLHGFPTQKPSFNPLLRSPPATATATNTRRLFLTTTSKPSPFTSLPKPLKPISAASTSVSSVAEPKKTQLQGAKIVPLVVSIAIGLLVRFVVPKPVEVTAQAWQLLSIFVSTIAGLVLSPLPVGAWALLGLTTTIITKTLTFT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017148`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017148

Location Chr03:142014256-142018639 (-)

Description Similar to DIT2-1: Dicarboxylate transporter 2.1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g64290`	Glutamate/malate translocator involved with DIT1 in primary ammonia assimilation and in the re-assimilation of ammonia generated by the photorespiratory pathway.	The Arabidopsis mutant dct is deficient in the plastidic glutamate/malate translocator DiT2.2003 · DOI: 10.1046/j.1365-313x.2003.01806.x
`At5g64280`	May be involved in the transport of dicarboxylate compounds.	No verified direct reference in this release
`At5g12860`	2-oxoglutarate/malate translocator involved with DIT2-1 in primary ammonia assimilation and in the re-assimilation of ammonia generated by the photorespiratory pathway.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017148 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009624 response to nematode Biological Process

GO:0015729 oxaloacetate transport Biological Process

GO:0015742 alpha-ketoglutarate transport Biological Process

GO:0015743 malate transport Biological Process

GO:0015813 L-glutamate transmembrane transport Biological Process

GO:0019676 ammonia assimilation cycle Biological Process

GO:0071423 malate transmembrane transport Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009536 plastid Cellular Component

GO:0009706 chloroplast inner membrane Cellular Component

GO:0009941 chloroplast envelope Cellular Component

KEGG gene cross-reference

ath:AT5G12860

ath:AT5G64280

ath:AT5G64290

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.961

Rank 1 · LXL04_017148 · OH-1004

Endoplasmic reticulum0.027

Rank 2 · LXL04_017148 · OH-1004

Mitochondrion0.027

Rank 3 · LXL04_017148 · OH-1004

Cell membrane0.024

Rank 4 · LXL04_017148 · OH-1004

Peroxisome0.022

Rank 5 · LXL04_017148 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00939.26Na_sulph_symp191-658 aa

PF03600.23CitMHS233-599 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017148	`PF00939.26`	Na_sulph_symp	191	658	1.7e-133	446.8
LXL04_017148	`PF03600.23`	CitMHS	233	599	1.9e-14	54.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FMF7`	Arabidopsis thaliana	Dicarboxylate transporter 2.1, chloroplastic	73.158%	Swiss-Prot	strong database homology
`Q9FMF8`	Arabidopsis thaliana	Dicarboxylate transporter 2.2, chloroplastic	64.437%	Swiss-Prot	strong database homology
`Q9LXV3`	Arabidopsis thaliana	Dicarboxylate transporter 1, chloroplastic	49.689%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card