TkA08G228650 | RubberDandelionOmics

Gene overview

TkA08G228650

Reference: TK1151 Chr: Chr08 Coordinates: 59527799-59530047 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1708 bp · TkA08G228650|TK1151|cDNA

TTACAATCCACTACCGAGATACTCCATCTTTCTCACACTTGCTGTACATATTTTTCTTTATCGTCACATAGCAAGATATACATAGCAATATCTTGCAATGCATCACACTATTTGTACAACAAACATAAGATGAAAGGTATTTGCCATGGTCTCCCAAAGTCCCCTCAAGCCTAAGAGATAGCTTAGGTCTATCTTTTGATTTCTCCAATTCAAACTCAGATATGTTCAAATATTTTGTGCTTATTTACTTGTACAAACTA...

CDS

Download CDS FASTA

831 bp · TkA08G228650|TK1151|CDS

ATGTATACGATAAATCCTACAATGATAACCCCTCGATTCCCCTTCTTAAACCCTACTCGAGGTGTACCCAAGTTCGGATTTTCAACAATATATCACCCCAAAAAGGGATTTCATGGAGTATCAATAACAAAAACGGCATGGAGTTTAGAAAGAATCAACGCAGGTATTAAAAGGAGCAAGTCTGGGAACGTACGACCCGCAACAGAGCCTTACACTGACGAAGCAATCCAAGCTGTAAAATCCGGAAAGGTAATAGCCGT...

Protein

Download Protein FASTA

276 aa · TkA08G228650|TK1151|PROTEIN

MYTINPTMITPRFPFLNPTRGVPKFGFSTIYHPKKGFHGVSITKTAWSLERINAGIKRSKSGNVRPATEPYTDEAIQAVKSGKVIAVPTDTLYGFACDACYVEAVNRIYEIKGRKHTSPLAICVGDINHIPRFAVTTHLPPGLLDSLLPGPVTLVLTRGESSILAKSLNAGLDTVGVRIPDFEFIRMIARGSGSALALTSANLSGKPSSLDIKEFKNLWEHCSFVYDGGVLPAGRAGSTIVDLTITGKYKILRPGSAKEE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G228650`
TK1151 ID	TkA08G228650
OH-1004 ID	LXL04_033069
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	96.100
Protein coverage (%)	TK1151 92.391 / OH-1004 75.444 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G228650`
Location	Chr08:59527799-59530047 (-)
Description	Similar to Yrdc: YrdC domain-containing protein, mitochondrial
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_033069` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0002949 tRNA threonylcarbamoyladenosine modification Biological Process GO:0006450 regulation of translational fidelity Biological Process GO:0008033 tRNA processing Biological Process GO:0051051 negative regulation of transport Biological Process GO:0070900 mitochondrial tRNA modification Biological Process GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005759 mitochondrial matrix Cellular Component GO:0005886 plasma membrane Cellular Component GO:0016020 membrane Cellular Component GO:0000049 tRNA binding Molecular Function GO:0003725 double-stranded RNA binding Molecular Function
KEGG gene cross-reference	bta:512062 hsa:79693 mja:MJ_0062 mmu:230734 rno:319113 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.679

Rank 1 · TkA08G228650 · TK1151

Plastid0.238

Rank 2 · TkA08G228650 · TK1151

Cytoplasm0.105

Rank 3 · TkA08G228650 · TK1151

Nucleus0.052

Rank 4 · TkA08G228650 · TK1151

Peroxisome0.029

Rank 5 · TkA08G228650 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01300Sua5_yciO_yrdC78-255 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G228650	`PF01300`	Sua5_yciO_yrdC	78	255	7.2e-45	153.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card