TkA08G220870 | RubberDandelionOmics

Gene overview

TkA08G220870

Reference: TK1151 Chr: Chr08 Coordinates: 57748875-57750789 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1130 bp · TkA08G220870|TK1151|cDNA

AAAATAGTGTATTCCTATTTCACACATTTAACTTCCCCGTACTTTATCAGCATAAACATTAAACACTCTTCGATTTTTGGTTGCGTTTTCGTCTCTGGATTCTCACAGTAAGCTTTCTTCTCCTTCTATGGCGTCATTTGTGACCACCTGTTCCTTATCTCGTTCACTCCGATTCGCTACTACGAAACCCTATTATTATGCATCTCCACTCCCCTCAATTTTAACTAGTTCCCCTAAACAGGTGTCCCTGAAACTCCGTC...

CDS

Download CDS FASTA

726 bp · TkA08G220870|TK1151|CDS

ATGGCGTCATTTGTGACCACCTGTTCCTTATCTCGTTCACTCCGATTCGCTACTACGAAACCCTATTATTATGCATCTCCACTCCCCTCAATTTTAACTAGTTCCCCTAAACAGGTGTCCCTGAAACTCCGTCGTTTTATATCCACGGCAATGGCTTCGGAATCGGTTCAGAATGAATCGCCGTCAAATAATCCAGGGCTCCTAAGTACACCTCCAGATAAAGAAACCAATGGCTACTTCATGCAACAAACGATGTATCG...

Protein

Download Protein FASTA

241 aa · TkA08G220870|TK1151|PROTEIN

MASFVTTCSLSRSLRFATTKPYYYASPLPSILTSSPKQVSLKLRRFISTAMASESVQNESPSNNPGLLSTPPDKETNGYFMQQTMYRIKDPKVSLDFYSRVLGMSLLKRLDFPDMKFTLYFMGYEDTSSAPEDPVDRTTWTFGKKATIELTHNWGTENDPNFKGHHNGNSEPLGFGHIGITVDDTYKACERFARLNVEFVKKPDDGKLKGIAFIKDPDGYWIEIFDTKTIGNVAKVTPTKE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G220870`
TK1151 ID	TkA08G220870
OH-1004 ID	LXL04_033013
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 38.746 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G220870

Location Chr08:57748875-57750789 (-)

Description Similar to GLXI: Lactoylglutathione lyase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g08110`	Catalyzes the conversion of hemimercaptal, formed from methylglyoxal and glutathione, to S-lactoylglutathione.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033013 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0019243 methylglyoxal catabolic process to D-lactate via S-lactoyl-glutathione Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004462 lactoylglutathione lyase activity Molecular Function

GO:0019904 protein domain specific binding Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G08110

cam:101505694

gmx:547667

sly:544161

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.912

Rank 1 · TkA08G220870 · TK1151

Mitochondrion0.131

Rank 2 · TkA08G220870 · TK1151

Cytoplasm0.035

Rank 3 · TkA08G220870 · TK1151

Nucleus0.024

Rank 4 · TkA08G220870 · TK1151

Peroxisome0.016

Rank 5 · TkA08G220870 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00903Glyoxalase83-224 aa

PF13669Glyoxalase_483-206 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G220870	`PF00903`	Glyoxalase	83	224	4.2e-24	86.0
TkA08G220870	`PF13669`	Glyoxalase_4	83	206	4.2e-05	24.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8H0V3`	Arabidopsis thaliana	sp\|Q8H0V3\|LGUL_ARATH Lactoylglutathione lyase	77.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card