TkA08G215220 | RubberDandelionOmics

Gene overview

TkA08G215220

Reference: TK1151 Chr: Chr08 Coordinates: 56286064-56287245 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1149 bp · TkA08G215220|TK1151|cDNA

ATGATGAAGGCGTCAGTGCGTCCGATATTCAGCGTTGTGTTTCTCATTGCCGCCGCCGCCACTCTCTGCTTTCGAATCATGGTTTCCGGCGGTGGTGGGGAAGCTCAGAAGCCTGCACCGATCTTCAATGACACATTATTAAGGTTCGCTGCGATTGACCTAGCTGAAGATTCGCTCAGACGAGATGTCGAACAGTTGGTGGACGGTAATTTCCGAACCATGGATGGCAGTCGCCAGCGCTCGTTTTTATGGTCAGGCCG...

CDS

Download CDS FASTA

1149 bp · TkA08G215220|TK1151|CDS

ATGATGAAGGCGTCAGTGCGTCCGATATTCAGCGTTGTGTTTCTCATTGCCGCCGCCGCCACTCTCTGCTTTCGAATCATGGTTTCCGGCGGTGGTGGGGAAGCTCAGAAGCCTGCACCGATCTTCAATGACACATTATTAAGGTTCGCTGCGATTGACCTAGCTGAAGATTCGCTCAGACGAGATGTCGAACAGTTGGTGGACGGTAATTTCCGAACCATGGATGGCAGTCGCCAGCGCTCGTTTTTATGGTCAGGCCG...

Protein

Download Protein FASTA

382 aa · TkA08G215220|TK1151|PROTEIN

MMKASVRPIFSVVFLIAAAATLCFRIMVSGGGGEAQKPAPIFNDTLLRFAAIDLAEDSLRRDVEQLVDGNFRTMDGSRQRSFLWSGRHRIDIRVRSARGIPVLLRSPEFYRLWLDFRRYLQNWWRNRRFQPDVMSDMINTVKTLTTGVNSTAPKSGSKYKTCAVVGNSGILLKSDLGSLIDSHEFVIRLNNARTGGFEHNVGAKTSLSFVNSNILHLCARREGCFCHPYGATVPIMMYMCQMIHFLDYIVCNSSHKSPLM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G215220`
TK1151 ID	TkA08G215220
OH-1004 ID	LXL04_032943
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G215220

Location Chr08:56286064-56287245 (-)

Description Similar to GALT29A: Beta-1,6-galactosyltransferase GALT29A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g08280`	Galactosyltransferase involved in the biosynthesis of type II arabinogalactan.	Galactosyltransferases from Arabidopsis thaliana in the biosynthesis of type II arabinogalactan: molecular interaction enhances enzyme activity.2014 · DOI: 10.1186/1471-2229-14-90

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2WX64`	Possesses sialyltransferase-like activity in vitro.	No verified direct reference in this release
`Os01g0858900`	Possesses sialyltransferase-like activity in vitro.	Analysis of sialyltransferase-like proteins from Oryza sativa.2006 · DOI: 10.1093/jb/mvj029
`UniProt: A2ZI41`	Does not possess sialyltransferase-like activity in vitro.	No verified direct reference in this release
`Os12g0151500`	Does not possess sialyltransferase-like activity in vitro.	Analysis of sialyltransferase-like proteins from Oryza sativa.2006 · DOI: 10.1093/jb/mvj029

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032943 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009101 glycoprotein biosynthetic process Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0008373 sialyltransferase activity Molecular Function

GO:0008378 galactosyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G08280

dosa:Os01g0858900

dosa:Os12g0151500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.782

Rank 1 · TkA08G215220 · TK1151

Endoplasmic reticulum0.093

Rank 2 · TkA08G215220 · TK1151

Extracellular0.078

Rank 3 · TkA08G215220 · TK1151

Cell membrane0.078

Rank 4 · TkA08G215220 · TK1151

Cytoplasm0.077

Rank 5 · TkA08G215220 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11612T2SSJ44-88 aa

PF00777Glyco_transf_29119-361 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G215220	`PF11612`	T2SSJ	44	88	0.16	12.7
TkA08G215220	`PF00777`	Glyco_transf_29	119	361	2.1e-41	142.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SGD2`	Arabidopsis thaliana	sp\|Q9SGD2\|GT29A_ARATH Beta-1,6-galactosyltransferase GALT29A	50.400%	Swiss-Prot	High
`A2WX64`	Oryza sativa subsp. indica	sp\|A2WX64\|STLP1_ORYSI Sialyltransferase-like protein 1	47.100%	Swiss-Prot	Medium
`Q94DD4`	Oryza sativa subsp. japonica	sp\|Q94DD4\|STLP1_ORYSJ Sialyltransferase-like protein 1	47.100%	Swiss-Prot	Medium
`A2ZI41`	Oryza sativa subsp. indica	sp\|A2ZI41\|STLP2_ORYSI Sialyltransferase-like protein 2	59.700%	Swiss-Prot	Medium
`Q2QXM3`	Oryza sativa subsp. japonica	sp\|Q2QXM3\|STLP2_ORYSJ Sialyltransferase-like protein 2	59.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card