LXL04_032943 | RubberDandelionOmics

Gene overview

LXL04_032943

Reference: OH-1004 Chr: Chr07 Coordinates: 31994643-31995824 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1182 bp · LXL04_032943|LXL04_032943|OH1004|cDNA

ATGATGAAGGCGTCAGTGCGTCCGATATTCAGCGTTGTGTTTCTCATTGCCGCCGCCGCCACTCTCTGCTTTCGAATCATGGTTtccggcggcggtggtggcggGGAATTCTTTTCCCGTAACTACGTCGGGGAAGCTCAGAAGCCTGCACCGATCTTCAATGACACATTATTAAGGTTCGCTGCGATTGACCTAGCTGAAGATTCGCTCAGACGAGATGTCGAACAGTTGGTGGACGGTAATTTCCGAACCATGGATGG...

CDS

Download CDS FASTA

1182 bp · LXL04_032943|LXL04_032943|OH1004|CDS

ATGATGAAGGCGTCAGTGCGTCCGATATTCAGCGTTGTGTTTCTCATTGCCGCCGCCGCCACTCTCTGCTTTCGAATCATGGTTTCCGGCGGCGGTGGTGGCGGGGAATTCTTTTCCCGTAACTACGTCGGGGAAGCTCAGAAGCCTGCACCGATCTTCAATGACACATTATTAAGGTTCGCTGCGATTGACCTAGCTGAAGATTCGCTCAGACGAGATGTCGAACAGTTGGTGGACGGTAATTTCCGAACCATGGATGG...

Protein

Download Protein FASTA

393 aa · LXL04_032943|LXL04_032943|OH1004|PROTEIN

MMKASVRPIFSVVFLIAAAATLCFRIMVSGGGGGGEFFSRNYVGEAQKPAPIFNDTLLRFAAIDLAEDSLRRDVEQLVDGNFRTMDGSRQRSFLWSGRHRIDIRVRSARGIPVLLRSPEFYRLWLDFRRYLQNWWRNRRFQPDVMSDMINTVKTLTTGVNSTAPKSGSKYKTCAVVGNSGILLKSDLGSLIDSHEFVIRLNNARTGGFEHNVGAKTSLSFVNSNILHLCARREGCFCHPYGATVPIMMYMCQMIHFLDYI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032943`
TK1151 ID	TkA08G215220
OH-1004 ID	LXL04_032943
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032943

Location Chr07:31994643-31995824 (-)

Description Similar to GALT29A: Beta-1,6-galactosyltransferase GALT29A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g08280`	Galactosyltransferase involved in the biosynthesis of type II arabinogalactan.	Galactosyltransferases from Arabidopsis thaliana in the biosynthesis of type II arabinogalactan: molecular interaction enhances enzyme activity.2014 · DOI: 10.1186/1471-2229-14-90

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2WX64`	Possesses sialyltransferase-like activity in vitro.	No verified direct reference in this release
`Os01g0858900`	Possesses sialyltransferase-like activity in vitro.	Analysis of sialyltransferase-like proteins from Oryza sativa.2006 · DOI: 10.1093/jb/mvj029
`UniProt: A2ZI41`	Does not possess sialyltransferase-like activity in vitro.	No verified direct reference in this release
`Os12g0151500`	Does not possess sialyltransferase-like activity in vitro.	Analysis of sialyltransferase-like proteins from Oryza sativa.2006 · DOI: 10.1093/jb/mvj029

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032943 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009101 glycoprotein biosynthetic process Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0008373 sialyltransferase activity Molecular Function

GO:0008378 galactosyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G08280

dosa:Os01g0858900

dosa:Os12g0151500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.785

Rank 1 · LXL04_032943 · OH-1004

Endoplasmic reticulum0.092

Rank 2 · LXL04_032943 · OH-1004

Cell membrane0.076

Rank 3 · LXL04_032943 · OH-1004

Cytoplasm0.076

Rank 4 · LXL04_032943 · OH-1004

Extracellular0.075

Rank 5 · LXL04_032943 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00777.24Glyco_transf_29130-372 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032943	`PF00777.24`	Glyco_transf_29	130	372	2.3e-41	142.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SGD2`	Arabidopsis thaliana	Beta-1,6-galactosyltransferase GALT29A	50.623%	Swiss-Prot	strong database homology
`A2WX64`	Oryza sativa subsp. indica	Sialyltransferase-like protein 1	45.885%	Swiss-Prot	moderate database homology
`Q94DD4`	Oryza sativa subsp. japonica	Sialyltransferase-like protein 1	45.885%	Swiss-Prot	moderate database homology
`A2ZI41`	Oryza sativa subsp. indica	Sialyltransferase-like protein 2	59.664%	Swiss-Prot	moderate database homology
`Q2QXM3`	Oryza sativa subsp. japonica	Sialyltransferase-like protein 2	59.494%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card