TkA08G202410 | RubberDandelionOmics

Gene overview

TkA08G202410

Reference: TK1151 Chr: Chr08 Coordinates: 52941191-52949983 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1323 bp · TkA08G202410|TK1151|cDNA

ATGAAGCATTCATCTGCTGGAAAGGATGAACTCGAAGAAGGAGGAGACATAATAAGCACATTACCCGACGCACTGCTTACACGAATCCTCTCATTTCTCCCCCAAGCTGATGTGAAACAGTCGCGCATTTTGTCGAACAGGTGGAAGGACATCTGGGCGTTTCTTCCAAACCTCCGAATAGTCATGCCCTTTATCTGGTCAAGTGAAATAGCCAAAAAGTTTTACGATTTCGTTGATCGAACCCTTGCCATTCGTGATGG...

CDS

Download CDS FASTA

1323 bp · TkA08G202410|TK1151|CDS

ATGAAGCATTCATCTGCTGGAAAGGATGAACTCGAAGAAGGAGGAGACATAATAAGCACATTACCCGACGCACTGCTTACACGAATCCTCTCATTTCTCCCCCAAGCTGATGTGAAACAGTCGCGCATTTTGTCGAACAGGTGGAAGGACATCTGGGCGTTTCTTCCAAACCTCCGAATAGTCATGCCCTTTATCTGGTCAAGTGAAATAGCCAAAAAGTTTTACGATTTCGTTGATCGAACCCTTGCCATTCGTGATGG...

Protein

Download Protein FASTA

440 aa · TkA08G202410|TK1151|PROTEIN

MKHSSAGKDELEEGGDIISTLPDALLTRILSFLPQADVKQSRILSNRWKDIWAFLPNLRIVMPFIWSSEIAKKFYDFVDRTLAIRDGMPIERFYLYCSNTCDYDRAYDCLCTVVKSKVQKLELRFPHPKFRVKLCWDLFKTCDTLVELTLRGEFALDVPESELLFPCLKKINLLSIIYPNDESLANLISGCPVLEELFVERHDIGYSDNLQMVKVSSRSLKILRISFLWRHHLDCKVVIDAPNLEYMHILDKISANYTLM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G202410`
TK1151 ID	TkA08G202410
OH-1004 ID	LXL04_032741
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	65.300
Protein coverage (%)	TK1151 100.000 / OH-1004 97.124 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G202410

Location Chr08:52941191-52949983 (-)

Description Similar to At5g44950: Putative F-box/FBD/LRR-repeat protein At5g44950

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g50710`	Putative FBD-associated F-box protein At3g50710.	No verified direct reference in this release
`At5g56380`	FBD-associated F-box protein At5g56380.	No verified direct reference in this release
`At5g22730`	FBD-associated F-box protein At5g22730.	No verified direct reference in this release
`At5g22670`	Putative F-box/FBD/LRR-repeat protein At5g22670.	No verified direct reference in this release
`At1g69630`	F-box/LRR-repeat protein 13.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032741 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT2G04230

ath:AT3G49030

ath:AT3G59190

ath:AT4G14103

ath:AT5G44950

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.662

Rank 1 · TkA08G202410 · TK1151

Cytoplasm0.419

Rank 2 · TkA08G202410 · TK1151

Endoplasmic reticulum0.051

Rank 3 · TkA08G202410 · TK1151

Cell membrane0.045

Rank 4 · TkA08G202410 · TK1151

Plastid0.026

Rank 5 · TkA08G202410 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box18-53 aa

PF12937F-box-like18-51 aa

PF24758LRR_At5g56370113-256 aa

PF07723LRR_2167-192 aa

PF12937F-box-like215-231 aa

PF07723LRR_2219-226 aa

PF07723LRR_2275-285 aa

PF08387FBD279-291 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G202410	`PF00646`	F-box	18	53	4.2e-06	27.2
TkA08G202410	`PF12937`	F-box-like	18	51	0.0028	18.1
TkA08G202410	`PF24758`	LRR_At5g56370	113	256	6.6e-16	59.4
TkA08G202410	`PF07723`	LRR_2	167	192	1.6e-06	29.2
TkA08G202410	`PF12937`	F-box-like	215	231	0.0028	18.1
TkA08G202410	`PF07723`	LRR_2	219	226	1.6e-06	29.2
TkA08G202410	`PF07723`	LRR_2	275	285	1.6e-06	29.2
TkA08G202410	`PF08387`	FBD	279	291	1.8e-06	28.4
TkA08G202410	`PF08387`	FBD	367	412	1.8e-06	28.4
TkA08G202410	`PF24758`	LRR_At5g56370	398	414	6.6e-16	59.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SCQ5`	Arabidopsis thaliana	sp\|Q9SCQ5\|FBD10_ARATH Putative FBD-associated F-box protein At3g50710	28.400%	Swiss-Prot	Low
`Q9FM93`	Arabidopsis thaliana	sp\|Q9FM93\|FBD38_ARATH FBD-associated F-box protein At5g56380	30.800%	Swiss-Prot	Medium
`Q9FNI8`	Arabidopsis thaliana	sp\|Q9FNI8\|FBD32_ARATH FBD-associated F-box protein At5g22730	28.600%	Swiss-Prot	Low
`Q9FNJ4`	Arabidopsis thaliana	sp\|Q9FNJ4\|FDL32_ARATH Putative F-box/FBD/LRR-repeat protein At5g22670	31.000%	Swiss-Prot	Medium
`Q9FWZ1`	Arabidopsis thaliana	sp\|Q9FWZ1\|FBL13_ARATH F-box/LRR-repeat protein 13	32.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card