LXL04_032741 | RubberDandelionOmics

Gene overview

LXL04_032741

Reference: OH-1004 Chr: Chr07 Coordinates: 28807856-28809531 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1359 bp · LXL04_032741|LXL04_032741|OH1004|cDNA

ATGATGAATTTGAGCTCCCGCAAAGTGATGTGCAAACGGCAGAAGCAGTCATCTGCATGCGACGAAATCAAAGAAGGAGAAGACTTCATAAGCAAATTACCGAATGCACTGCTCATAGTAATCCTCTCATTTCTCCCTGAAGCTGATGCCGTTCGGACATGCATCTTGTCGAACAGGTGGAAATACATCTGGGCGTTTCTCCCAAATCTGAGTCTCGTTATGCCTTTTTGTTGGTCGACTGAAGAAGCCAACCAATTTCA...

CDS

Download CDS FASTA

1359 bp · LXL04_032741|LXL04_032741|OH1004|CDS

ATGATGAATTTGAGCTCCCGCAAAGTGATGTGCAAACGGCAGAAGCAGTCATCTGCATGCGACGAAATCAAAGAAGGAGAAGACTTCATAAGCAAATTACCGAATGCACTGCTCATAGTAATCCTCTCATTTCTCCCTGAAGCTGATGCCGTTCGGACATGCATCTTGTCGAACAGGTGGAAATACATCTGGGCGTTTCTCCCAAATCTGAGTCTCGTTATGCCTTTTTGTTGGTCGACTGAAGAAGCCAACCAATTTCA...

Protein

Download Protein FASTA

452 aa · LXL04_032741|LXL04_032741|OH1004|PROTEIN

MMNLSSRKVMCKRQKQSSACDEIKEGEDFISKLPNALLIVILSFLPEADAVRTCILSNRWKYIWAFLPNLSLVMPFCWSTEEANQFHDFVDRILALRVGLSCRRFYLYCSKNCDYNRVYDCLCTVVKNKVEKIDLRFPADRFIVKFCWDLFRTSYTLVQLTLRGEFVLDVPEAEVLFPCLKKLNLISIAYVGDQVVTNLISGCPLLQELFVERQLIGHSDNMEMFKVTSHSLRRLRMSFASCVDGDYKVVIDAPNLKYMS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032741`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032741

Location Chr07:28807856-28809531 (-)

Description Similar to At5g44950: Putative F-box/FBD/LRR-repeat protein At5g44950

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g44950`	Putative F-box/FBD/LRR-repeat protein At5g44950.	No verified direct reference in this release
`At3g59190`	F-box/LRR-repeat protein At3g59190.	No verified direct reference in this release
`At4g14103`	F-box/LRR-repeat protein At4g14103.	No verified direct reference in this release
`At3g49030`	Putative F-box/FBD/LRR-repeat protein At3g49030.	No verified direct reference in this release
`At2g04230`	F-box/FBD/LRR-repeat protein At2g04230.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032741 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT2G04230

ath:AT3G49030

ath:AT3G59190

ath:AT4G14103

ath:AT5G44950

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.807

Rank 1 · LXL04_032741 · OH-1004

Cytoplasm0.266

Rank 2 · LXL04_032741 · OH-1004

Cell membrane0.037

Rank 3 · LXL04_032741 · OH-1004

Endoplasmic reticulum0.035

Rank 4 · LXL04_032741 · OH-1004

Plastid0.019

Rank 5 · LXL04_032741 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24758.2LRR_At5g56370129-262 aa

PF07723.20LRR_2179-204 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032741	`PF24758.2`	LRR_At5g56370	129	262	2.4e-10	41.2
LXL04_032741	`PF07723.20`	LRR_2	179	204	3.6e-06	28.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLA2`	Arabidopsis thaliana	Putative F-box/FBD/LRR-repeat protein At5g44950	29.604%	Swiss-Prot	weak database homology
`Q1PED9`	Arabidopsis thaliana	F-box/LRR-repeat protein At3g59190	30.411%	Swiss-Prot	moderate database homology
`Q8L7H1`	Arabidopsis thaliana	F-box/LRR-repeat protein At4g14103	29.111%	Swiss-Prot	weak database homology
`Q9SMU0`	Arabidopsis thaliana	Putative F-box/FBD/LRR-repeat protein At3g49030	27.805%	Swiss-Prot	weak database homology
`Q6NKX3`	Arabidopsis thaliana	F-box/FBD/LRR-repeat protein At2g04230	28.910%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card