TkA08G117000 | RubberDandelionOmics

Gene overview

TkA08G117000

Reference: TK1151 Chr: Chr08 Coordinates: 30492835-30494604 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1167 bp · TkA08G117000|TK1151|cDNA

AAGCAAAAGAAAAAAAAAAAACACAGTATACGGTGAGAGAGAGAGAGAGAGAGAGTCTATTCCGCCGGAGGCTCTTCTTCCTGAAAGGTGAAGTTTGATTAAGCTTCAATGTCTCCTCCATTTTCTCTTCCTCTCGCAGCTGAAAATGAATATTGGACAGATGAAGGCATCTTTACGTCCTTACAGAATTTCAAAACAGGAAAACCGCTACCTGCAAATGTAGATTCGGAACTAAATCCTTATCAGTATCGGCCCCAAGA...

CDS

Download CDS FASTA

819 bp · TkA08G117000|TK1151|CDS

ATGTCTCCTCCATTTTCTCTTCCTCTCGCAGCTGAAAATGAATATTGGACAGATGAAGGCATCTTTACGTCCTTACAGAATTTCAAAACAGGAAAACCGCTACCTGCAAATGTAGATTCGGAACTAAATCCTTATCAGTATCGGCCCCAAGATCTACCTGGTGATCTGTGGTACTTTTGTTCGACGGTGAAAAAAGAATCAGATATCGGATTCTGGCAGGAAACAGGGGAGCCATGCGAGATATTCTCTAATTCCGCCAT...

Protein

Download Protein FASTA

272 aa · TkA08G117000|TK1151|PROTEIN

MSPPFSLPLAAENEYWTDEGIFTSLQNFKTGKPLPANVDSELNPYQYRPQDLPGDLWYFCSTVKKESDIGFWQETGEPCEIFSNSAISGFRTTLRFYEGNAPHGRKTDWVMQEYRITEKYKTNVNDDHRALCRVFLAAENSSETECFLTGDYLELNDLIDDSGRSSMSTNSSCLTMTSDEYFDSMALLQQLDDDENMKDSSIIKFNLSAHVNSKSVICPTTTLSLKNESSEAKEENRNGSTSISSSSEEEKKKENVIKTK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G117000`
TK1151 ID	TkA08G117000
OH-1004 ID	LXL04_031607
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 99.265 / OH-1004 93.750 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G117000

Location Chr08:30492835-30494604 (+)

Description Similar to NAC053: NAC domain-containing protein 53

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g33060`	Transcriptional activator activated by proteolytic cleavage through regulated intramembrane proteolysis (RIP).	No verified direct reference in this release
`At1g71930`	May bind promoters of secondary cell-wall genes and activate transcription.	Transcription switches for protoxylem and metaxylem vessel formation.2005 · DOI: 10.1101/gad.1331305 Vascular-related NAC-DOMAIN7 is involved in the differentiation of all types of xylem vessels in Arabidopsis roots and shoots.2008 · DOI: 10.1111/j.1365-313x.2008.03533.x A battery of transcription factors involved in the regulation of secondary cell wall biosynthesis in Arabidopsis.2008 · DOI: 10.1105/tpc.108.061325 ASYMMETRIC LEAVES2-LIKE19/LATERAL ORGAN BOUNDARIES DOMAIN30 and ASL20/LBD18 regulate tracheary element differentiation in Arabidopsis.2008 · DOI: 10.1105/tpc.108.061796 MYB58 and MYB63 are transcriptional activators of the lignin biosynthetic pathway during secondary cell wall formation in Arabidopsis.2009 · DOI: 10.1105/tpc.108.063321 MYB83 is a direct target of SND1 and acts redundantly with MYB46 in the regulation of secondary cell wall biosynthesis in Arabidopsis.2009 · DOI: 10.1093/pcp/pcp139 VASCULAR-RELATED NAC-DOMAIN6 and VASCULAR-RELATED NAC-DOMAIN7 effectively induce transdifferentiation into xylem vessel elements under control of an induction system.2010 · DOI: 10.1104/pp.110.154013 Global analysis of direct targets of secondary wall NAC master switches in Arabidopsis.2010 · DOI: 10.1093/mp/ssq062 VASCULAR-RELATED NAC-DOMAIN7 directly regulates the expression of a broad range of genes for xylem vessel formation.2011 · DOI: 10.1111/j.1365-313x.2011.04514.x The Arabidopsis thaliana checkpoint kinase WEE1 protects against premature vascular differentiation during replication stress.2011 · DOI: 10.1105/tpc.110.082768 Verticillium infection triggers VASCULAR-RELATED NAC DOMAIN7-dependent de novo xylem formation and enhances drought tolerance in Arabidopsis.2012 · DOI: 10.1105/tpc.112.103374

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0530400`	Probable transcription factor involved in stress response.	No verified direct reference in this release
`Os03g0133000`	Transcription activator that binds sequence-specific DNA motifs.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031607 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009733 response to auxin Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009819 drought recovery Biological Process

GO:0010029 regulation of seed germination Biological Process

GO:0010150 leaf senescence Biological Process

GO:0010468 regulation of gene expression Biological Process

KEGG gene cross-reference

ath:AT1G33060

ath:AT2G33480

ath:AT3G10500

ath:AT5G39610

dosa:Os03g0119966

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.822

Rank 1 · TkA08G117000 · TK1151

Cytoplasm0.200

Rank 2 · TkA08G117000 · TK1151

Cell membrane0.096

Rank 3 · TkA08G117000 · TK1151

Endoplasmic reticulum0.051

Rank 4 · TkA08G117000 · TK1151

Plastid0.022

Rank 5 · TkA08G117000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02365NAM21-116 aa

PF02365NAM248-253 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G117000	`PF02365`	NAM	21	116	3.5e-14	54.0
TkA08G117000	`PF02365`	NAM	248	253	3.5e-14	54.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B5X570`	Arabidopsis thaliana	sp\|B5X570\|NAC14_ARATH NAC domain-containing protein 14	32.400%	Swiss-Prot	Low
`Q9C8W9`	Arabidopsis thaliana	sp\|Q9C8W9\|NAC30_ARATH NAC domain-containing protein 30	30.500%	Swiss-Prot	Low
`Q5Z6B6`	Oryza sativa subsp. japonica	sp\|Q5Z6B6\|NAC76_ORYSJ NAC domain-containing protein 76	33.100%	Swiss-Prot	Low
`Q10S65`	Oryza sativa subsp. japonica	sp\|Q10S65\|NAC22_ORYSJ NAC domain-containing protein 22	32.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card