TkA08G112730 | RubberDandelionOmics

Gene overview

TkA08G112730

Reference: TK1151 Chr: Chr08 Coordinates: 29329077-29329859 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

753 bp · TkA08G112730|TK1151|cDNA

ATGTTGAACTCTGTGATTGTCGGAAGCAATGGTGGCGGCGGCGGAGGCGGAGGAGGAGAACGGAGGAAGCAAGAGCGAAGAACAGCTCAGGCGAGTTCGAGAAAAGGGTGCATGAGAGGGAAAGGCGGACCGGAGAATGCTTCTTGTACATATAAAGGGGTGCGTCAAAGGACATGGGGGAAGTGGGTGTCGGAGATACGCGAACCTAACCGCGGCAGCCGTGTATGGTTGGGGACTTTCAACTCCGCCCGTGAAGCCGC...

CDS

Download CDS FASTA

753 bp · TkA08G112730|TK1151|CDS

ATGTTGAACTCTGTGATTGTCGGAAGCAATGGTGGCGGCGGCGGAGGCGGAGGAGGAGAACGGAGGAAGCAAGAGCGAAGAACAGCTCAGGCGAGTTCGAGAAAAGGGTGCATGAGAGGGAAAGGCGGACCGGAGAATGCTTCTTGTACATATAAAGGGGTGCGTCAAAGGACATGGGGGAAGTGGGTGTCGGAGATACGCGAACCTAACCGCGGCAGCCGTGTATGGTTGGGGACTTTCAACTCCGCCCGTGAAGCCGC...

Protein

Download Protein FASTA

250 aa · TkA08G112730|TK1151|PROTEIN

MLNSVIVGSNGGGGGGGGGERRKQERRTAQASSRKGCMRGKGGPENASCTYKGVRQRTWGKWVSEIREPNRGSRVWLGTFNSAREAAIAYDAAARRLYGPNAHVNLPDENAPAPPPPPAVTEAAKEARYHRAIEQMKKQQEFERQIQIYMHQQQQQQNIKIEIDSTSIPEIPDLNGHTVANYHKRTGEKYVRPKSSNGNLNANLPEFDDSRLWTEAASTMDYESQAIDPGIAASSFNDAIGIELNHPLMV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G112730`
TK1151 ID	TkA08G112730
OH-1004 ID	LXL04_030512
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	59.500
Protein coverage (%)	TK1151 88.800 / OH-1004 91.393 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G112730

Location Chr08:29329077-29329859 (-)

Description Similar to DREB2D: Dehydration-responsive element-binding protein 2D

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g75490`	Putative transcriptional activator that binds specifically to the DNA sequence 5'-[AG]CCGAC-3'.	No verified direct reference in this release
`At5g18450`	Transcriptional activator that binds specifically to the DNA sequence 5'-[AG]CCGAC-3'.	No verified direct reference in this release
`At2g40350`	Putative transcriptional activator that binds specifically to the DNA sequence 5'-[AG]CCGAC-3'.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2WL19`	Transcriptional activator that binds specifically to the DNA sequence 5'-[AG]CCGAC-3'.	No verified direct reference in this release
`Os08g0565200`	Probable transcriptional activator that binds to the DNA sequence 5'-[AG]CCGAC-3' of the cis-acting dehydration-responsive element (DRE).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030512 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006950 response to stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0010286 heat acclimation Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT1G75490

ath:AT2G40340

ath:AT2G40350

ath:AT5G18450

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.961

Rank 1 · TkA08G112730 · TK1151

Cytoplasm0.087

Rank 2 · TkA08G112730 · TK1151

Cell membrane0.026

Rank 3 · TkA08G112730 · TK1151

Endoplasmic reticulum0.017

Rank 4 · TkA08G112730 · TK1151

Plastid0.015

Rank 5 · TkA08G112730 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12938M_domain14-20 aa

PF07245Phlebovirus_G230-50 aa

PF00847AP251-99 aa

PF12938M_domain124-164 aa

PF07245Phlebovirus_G2133-185 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G112730	`PF12938`	M_domain	14	20	4.7	7.7
TkA08G112730	`PF07245`	Phlebovirus_G2	30	50	0.059	13.0
TkA08G112730	`PF00847`	AP2	51	99	3.5e-13	50.4
TkA08G112730	`PF12938`	M_domain	124	164	4.7	7.7
TkA08G112730	`PF07245`	Phlebovirus_G2	133	185	0.059	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LQZ2`	Arabidopsis thaliana	sp\|Q9LQZ2\|DRE2D_ARATH Dehydration-responsive element-binding protein 2D	82.700%	Swiss-Prot	Low
`P61827`	Arabidopsis thaliana	sp\|P61827\|DRE2G_ARATH Dehydration-responsive element-binding protein 2G	75.700%	Swiss-Prot	Low
`Q9SIZ0`	Arabidopsis thaliana	sp\|Q9SIZ0\|DRE2H_ARATH Putative dehydration-responsive element-binding protein 2H	69.300%	Swiss-Prot	Low
`A2WL19`	Oryza sativa subsp. indica	sp\|A2WL19\|DRE2A_ORYSI Dehydration-responsive element-binding protein 2A	70.500%	Swiss-Prot	Low
`Q84ZA1`	Oryza sativa subsp. japonica	sp\|Q84ZA1\|DRE2C_ORYSJ Dehydration-responsive element-binding protein 2C	74.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card