TkA08G059600 | RubberDandelionOmics

Gene overview

TkA08G059600

Reference: TK1151 Chr: Chr08 Coordinates: 15298169-15300448 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1423 bp · TkA08G059600|TK1151|cDNA

AAAACACCACATTAGAAACTTGAAGATGATTTTAGAATTCTAGAAAAGCCATGTGGGGTCGCCATTTTGGGATCGAAAGCAGTCATGGTGGTTGTGTGTAAATTCAATGGCGGTTTCAAATCGACTTCAAATCCCCAATTCTTAACAAGAATTTCATCTGTTTTCTTCCCCTCTTCCTATATATTTCCTATTTTCTACACCACTTCTAAATCCACACTTTTTGAATTCCTCCAAATTTCAAACCCCACGACCACATAAAA...

CDS

Download CDS FASTA

879 bp · TkA08G059600|TK1151|CDS

ATGGCCAATCAAACCGTATCTTCAAAACTGGAGCCATGGCACGACTTAACCGGAAAAGTCGTGATGGTGACCGGAGCCTCATCCGGGCTCGGCCGCGACTTCTGTATCGACCTAGCGAAAGCCGGCTGTAGGATCATTGCGGCGGCTCGCCGGATAGACCGGCTCGTATCACTCTGCGATGAGATCAATCAACTTGGACGAAACGGCGGTGCCGGTACATCTGCTAATTGTGAGGTCGCCGACTATGTTAGGGCGGTGGC...

Protein

Download Protein FASTA

292 aa · TkA08G059600|TK1151|PROTEIN

MANQTVSSKLEPWHDLTGKVVMVTGASSGLGRDFCIDLAKAGCRIIAAARRIDRLVSLCDEINQLGRNGGAGTSANCEVADYVRAVAVELDVSGKGPTVEASVKKAWAAFGRIDGLINNAGVRGNVHSPLDLTEEEWESTMRTNLTGTWLVSKYVCIRMREAHHGGSIINISSIAGLDRGQLPGALAYATSKTGIVTLTKVMALEMGAYKIRVNSINPGLFRSEITEGLMEKDWLNNVAERTAPLRTFGTTDPALTKLAR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G059600`
TK1151 ID	TkA08G059600
OH-1004 ID	LXL04_000256
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	62.300
Protein coverage (%)	TK1151 91.781 / OH-1004 87.459 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G059600`
Location	Chr08:15298169-15300448 (+)
Description	Similar to fabG: 3-oxoacyl-[acyl-carrier-protein] reductase FabG (Thermotoga maritima (strain ATCC 43589 / MSB8 / DSM 3109 / JCM 10099)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_000256` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0030497 fatty acid elongation Biological Process GO:0005886 plasma membrane Cellular Component GO:0004316 3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity Molecular Function GO:0016491 oxidoreductase activity Molecular Function GO:0016616 oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor Molecular Function GO:0050661 NADP binding Molecular Function GO:0051287 NAD binding Molecular Function
KEGG gene cross-reference	mtc:MT0793 mtu:Rv0769 mtv:RVBD_0769 stm:STM2445 tma:TM0325 tma:TM1724 tmi:THEMA_03100 tmi:THEMA_05620 tmm:Tmari_0323 tmm:Tmari_1732 tmw:THMA_0332 tmw:THMA_1766 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Peroxisome0.501

Rank 1 · TkA08G059600 · TK1151

Cytoplasm0.374

Rank 2 · TkA08G059600 · TK1151

Nucleus0.149

Rank 3 · TkA08G059600 · TK1151

Mitochondrion0.125

Rank 4 · TkA08G059600 · TK1151

Plastid0.037

Rank 5 · TkA08G059600 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00106adh_short19-231 aa

PF08659KR21-177 aa

PF01370Epimerase21-155 aa

PF13561adh_short_C278-282 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G059600	`PF00106`	adh_short	19	231	8.5e-47	159.9
TkA08G059600	`PF08659`	KR	21	177	2e-07	31.8
TkA08G059600	`PF01370`	Epimerase	21	155	0.2	11.8
TkA08G059600	`PF13561`	adh_short_C2	78	282	1.3e-41	143.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card