Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1375 bp · TkA08G058880|TK1151|cDNA
TGGAAATTGATTTTGGGTTCTATAAACTGCCCAATTTTCATTTCAACGTTCGCCATTTTCGCCTCTCCCAAAGCTCTCTTTCTTTCTTTCTTTCAGTTCATCAACGGCGTCTGCAAAAGTAGAGGGTCACCTCCATTGCTGTTTCATCTGAGCACCTTCAACATCTCTTACCCCTAATTCACCAGTTATCAGTTAAATCTATTAAAAATGCCGGAAGCAAGAGATCGATTAGCGAGGCCAAACAGCGGAGTTGCAGAGAT...
804 bp · TkA08G058880|TK1151|CDS
ATGCCGGAAGCAAGAGATCGATTAGCGAGGCCAAACAGCGGAGTTGCAGAGATATATCGACTTCGTCGTTCCTCGGTCGATAGCATAGGGATTCTTCCTGATGACGGTGATAGCGAAATTAGTGTTAATCGGACTCCATTCAGGTGGGGTGCGACGCCGTTGACTGGTGATACTTCAGGTCAACCAATGGCTGTGGCTCCTTCTACTCGAACGATTGCCGGTGCCACCTCTAGTGTAGGTGGTGCTGGAAGGGGACTTTT...
Protein
Download Protein FASTA267 aa · TkA08G058880|TK1151|PROTEIN
MPEARDRLARPNSGVAEIYRLRRSSVDSIGILPDDGDSEISVNRTPFRWGATPLTGDTSGQPMAVAPSTRTIAGATSSVGGAGRGLFGTPRTVYRRGGRSQNTPPSGSTVRRARGRSGSQSVLPSWYPRTPLGDITHVVRAIERRRAHLVGGEGQVLGSPTPIRIGHPHTVHDPSPSGAHLEHELSLVTPNPKLASKTFRPPPLKIFADVPNQVDGESDFMTPQKKLLNSIDIVEKVVMEELHRLKRTPTAKKAEREKRV...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G058880 |
|---|---|
| TK1151 ID | TkA08G058880 |
| OH-1004 ID | LXL04_018407 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 96.600 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G058880 |
|---|---|
| Location | Chr08:15066670-15068444 (-) |
| Description | Similar to PYM: Protein POLYCHOME |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisRiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006260 DNA replication Biological Process GO:0006952 defense response Biological Process GO:0007088 regulation of mitotic nuclear division Biological Process GO:0007113 endomitotic cell cycle Biological Process GO:0007127 meiosis I Biological Process GO:0007135 meiosis II Biological Process GO:0009561 megagametogenesis Biological Process GO:0009960 endosperm development Biological Process GO:0010091 trichome branching Biological Process GO:0010224 response to UV-B Biological Process GO:0040020 regulation of meiotic nuclear division Biological Process GO:0042023 DNA endoreduplication Biological Process |
| KEGG gene cross-reference | ath:AT2G42260 ath:AT3G57860 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
No result was found for this query.
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.