TkA08G046480 | RubberDandelionOmics

Gene overview

TkA08G046480

Reference: TK1151 Chr: Chr08 Coordinates: 11826990-11831215 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1013 bp · TkA08G046480|TK1151|cDNA

AGGCAAGAAAGGCTCTAAATGAGAAATTAAGGAGGATGATAGAGAAGAGAAAGGAGAGTGGGGAGAAGGGAAAAGGATTGTTAGGAGCATTATTGTCAAACGAAGAAGATGAAGGGAAGAAGACGCTGATGAAGTTGAGTGATTCCGAGATTGCAGATAACATAATAGGGGTGATATTTGCAGCCCATGATACAACCGCAAGTGTTCTAACATGGCTCCTCAAATATTTACATGACAATCCCCATCTTCTCCATGTTGTT...

CDS

Download CDS FASTA

720 bp · TkA08G046480|TK1151|CDS

ATGATAGAGAAGAGAAAGGAGAGTGGGGAGAAGGGAAAAGGATTGTTAGGAGCATTATTGTCAAACGAAGAAGATGAAGGGAAGAAGACGCTGATGAAGTTGAGTGATTCCGAGATTGCAGATAACATAATAGGGGTGATATTTGCAGCCCATGATACAACCGCAAGTGTTCTAACATGGCTCCTCAAATATTTACATGACAATCCCCATCTTCTCCATGTTGTTAGGAGGGAACAAGAAGAAATACGGTGCAAAATACT...

Protein

Download Protein FASTA

239 aa · TkA08G046480|TK1151|PROTEIN

MIEKRKESGEKGKGLLGALLSNEEDEGKKTLMKLSDSEIADNIIGVIFAAHDTTASVLTWLLKYLHDNPHLLHVVRREQEEIRCKILEANRRITWEDTRRMPFTNRVIQETLRTASILSFTYREAVEDVEMEGYLIPKGWKVLPLFRSIHYSSEFFPHPHKFDPSRFEVAPQPNTYMPFGNGSHSCPGSELAKLEMFILLHHLTTTLRWEVIGEEGIQYGPFPVPRDGLPIKVQALKNI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G046480`
TK1151 ID	TkA08G046480
OH-1004 ID	LXL04_017836
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 48.687 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G046480

Location Chr08:11826990-11831215 (+)

Description Similar to CYP707A2: Abscisic acid 8'-hydroxylase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g29090`	Participates in ABA oxidative degradation but does not catalyze the isomerization of 8′-hydroxy-ABA to (−)-phaseic acid.	The Arabidopsis cytochrome P450 CYP707A encodes ABA 8'-hydroxylases: key enzymes in ABA catabolism.2004 · DOI: 10.1038/sj.emboj.7600121 CYP707A1 and CYP707A2, which encode abscisic acid 8'-hydroxylases, are indispensable for proper control of seed dormancy and germination in Arabidopsis.2006 · DOI: 10.1104/pp.106.079475
`At4g19230`	Involved in the oxidative degradation of abscisic acid.	The Arabidopsis cytochrome P450 CYP707A encodes ABA 8'-hydroxylases: key enzymes in ABA catabolism.2004 · DOI: 10.1038/sj.emboj.7600121 Arabidopsis CYP707As encode (+)-abscisic acid 8'-hydroxylase, a key enzyme in the oxidative catabolism of abscisic acid.2004 · DOI: 10.1104/pp.103.037614 CYP707A1 and CYP707A2, which encode abscisic acid 8'-hydroxylases, are indispensable for proper control of seed dormancy and germination in Arabidopsis.2006 · DOI: 10.1104/pp.106.079475
`At5g45340`	Participates in ABA oxidative degradation but does not catalyze the isomerization of 8′-hydroxy-ABA to (−)-phaseic acid.	Arabidopsis CYP707As encode (+)-abscisic acid 8'-hydroxylase, a key enzyme in the oxidative catabolism of abscisic acid.2004 · DOI: 10.1104/pp.103.037614 CYP707A3, a major ABA 8'-hydroxylase involved in dehydration and rehydration response in Arabidopsis thaliana.2006 · DOI: 10.1111/j.1365-313x.2006.02683.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017836 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001666 response to hypoxia Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009639 response to red or far red light Biological Process

GO:0009687 abscisic acid metabolic process Biological Process

GO:0009733 response to auxin Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009835 fruit ripening Biological Process

GO:0009856 pollination Biological Process

GO:0010114 response to red light Biological Process

GO:0046345 abscisic acid catabolic process Biological Process

GO:0048838 release of seed from dormancy Biological Process

GO:0050832 defense response to fungus Biological Process

KEGG gene cross-reference

ath:AT2G29090

ath:AT4G19230

ath:AT5G45340

sly:100136887

sly:101249565

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.733

Rank 1 · TkA08G046480 · TK1151

Cytoplasm0.108

Rank 2 · TkA08G046480 · TK1151

Nucleus0.061

Rank 3 · TkA08G046480 · TK1151

Mitochondrion0.060

Rank 4 · TkA08G046480 · TK1151

Peroxisome0.054

Rank 5 · TkA08G046480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00067p4505-215 aa

PF04548AIG120-79 aa

PF10174Cast75-124 aa

PF05755REF86-136 aa

PF04548AIG189-136 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G046480	`PF00067`	p450	5	215	2.7e-55	188.7
TkA08G046480	`PF04548`	AIG1	20	79	0.18	11.9
TkA08G046480	`PF10174`	Cast	75	124	0.34	9.8
TkA08G046480	`PF05755`	REF	86	136	0.043	14.4
TkA08G046480	`PF04548`	AIG1	89	136	0.18	11.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81077`	Arabidopsis thaliana	sp\|O81077\|ABAH2_ARATH Abscisic acid 8'-hydroxylase 2	75.200%	Swiss-Prot	High
`Q949P1`	Arabidopsis thaliana	sp\|Q949P1\|ABAH1_ARATH Abscisic acid 8'-hydroxylase 1	62.100%	Swiss-Prot	High
`Q9FH76`	Arabidopsis thaliana	sp\|Q9FH76\|ABAH3_ARATH Abscisic acid 8'-hydroxylase 3	60.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card