TkA08G041530 | RubberDandelionOmics

Gene overview

TkA08G041530

Reference: TK1151 Chr: Chr08 Coordinates: 10575766-10581886 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3665 bp · TkA08G041530|TK1151|cDNA

ATATAACCGAGGATAATATAGATTTTCGGACAATATAAACGTAAATAAATATTCGGGAGTATTCGCTTTTGGATTCCATCAGTCTCCTCAGCAACATACCCGAAATCAACGTAGAAAGTAACGAAGTTCTCACTTTCTCTCGCACAGAGAAAGCGAGGGATTCAACCTTTTCATTTCTATTTCTGGCCGCCCGCCGATCGACCGTCAACGACGACGAGGAAGATCCGATCCGCTCCGATCTGATCTCAGCTGGAATTTTT...

CDS

Download CDS FASTA

2889 bp · TkA08G041530|TK1151|CDS

ATGAAGATTTGGTGTTGTTTATGCTTCGGCGAAGAAGAAGAAGAATATAAGAACAAAAGTGCGACGATGGGGGAGAGGGAGGGCATTTTGGGAAATCTTGATTTTGATGATTGTAAGTATGAAGAAATAGGAAGCGATGAGGAATTAGGGTCTGGTAAACAAGATGATGGAGGGGAATTTCGATTGCAGCCTGGGGAGGGCACTTCTAAAAGCAGTGGTGAAGGTAGTACCTTGGAGGTGAATTTGAATTTGAGTTTGGG...

Protein

Download Protein FASTA

962 aa · TkA08G041530|TK1151|PROTEIN

MKIWCCLCFGEEEEEYKNKSATMGEREGILGNLDFDDCKYEEIGSDEELGSGKQDDGGEFRLQPGEGTSKSSGEGSTLEVNLNLSLGGESSSSSAVAVLERDGLDRDSHSKRPKVHSLALDCDSFLLSMPFQENMTDNEYERMHNTSSHYLCSASEEDASPLMSNIWRMEEDENVQPEIDDREIRMDLTDDLLHMVFSFLGHIDLCRAAEVCRQWRIASAHEDFWRILNFENRNISPLQFEDMCRRYPNATQVNINGSPA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G041530`
TK1151 ID	TkA08G041530
OH-1004 ID	LXL04_017904
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G041530

Location Chr08:10575766-10581886 (-)

Description Similar to FBL15: F-box/LRR-repeat protein 15

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g33210`	F-box/LRR-repeat protein 15.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017904 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0009266 response to temperature stimulus Biological Process

GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:1905393 plant organ formation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0019005 SCF ubiquitin ligase complex Cellular Component

KEGG gene cross-reference

ath:AT4G33210

mmu:72194

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.862

Rank 1 · TkA08G041530 · TK1151

Cytoplasm0.182

Rank 2 · TkA08G041530 · TK1151

Cell membrane0.041

Rank 3 · TkA08G041530 · TK1151

Endoplasmic reticulum0.025

Rank 4 · TkA08G041530 · TK1151

Mitochondrion0.022

Rank 5 · TkA08G041530 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box187-226 aa

PF12937F-box-like190-229 aa

PF23952LRR_EndoS237-276 aa

PF29594LRR_SKP2240-335 aa

PF13855LRR_8250-303 aa

PF24758LRR_At5g56370265-351 aa

PF12799LRR_4269-285 aa

PF23622LRR_At1g61320_AtMIF1269-397 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G041530	`PF00646`	F-box	187	226	2.5e-08	34.2
TkA08G041530	`PF12937`	F-box-like	190	229	3.6e-09	36.9
TkA08G041530	`PF23952`	LRR_EndoS	237	276	7.5e-06	26.9
TkA08G041530	`PF29594`	LRR_SKP2	240	335	1.3e-10	41.7
TkA08G041530	`PF13855`	LRR_8	250	303	6.3e-06	26.6
TkA08G041530	`PF24758`	LRR_At5g56370	265	351	3.4e-14	53.8
TkA08G041530	`PF12799`	LRR_4	269	285	3.6e-16	59.5
TkA08G041530	`PF23622`	LRR_At1g61320_AtMIF1	269	397	0.00034	20.8
TkA08G041530	`PF13516`	LRR_6	296	306	0.0015	19.1
TkA08G041530	`PF12799`	LRR_4	310	329	3.6e-16	59.5
TkA08G041530	`PF13855`	LRR_8	340	353	6.3e-06	26.6
TkA08G041530	`PF29594`	LRR_SKP2	347	432	1.3e-10	41.7
TkA08G041530	`PF24758`	LRR_At5g56370	351	439	3.4e-14	53.8
TkA08G041530	`PF23952`	LRR_EndoS	357	396	7.5e-06	26.9
TkA08G041530	`PF12799`	LRR_4	358	371	3.6e-16	59.5
TkA08G041530	`PF25372`	LRR_FBXL15	359	431	7.7e-07	28.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SMY8`	Arabidopsis thaliana	sp\|Q9SMY8\|FBL15_ARATH F-box/LRR-repeat protein 15	64.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card