TkA08G029900 | RubberDandelionOmics

Gene overview

TkA08G029900

Reference: TK1151 Chr: Chr08 Coordinates: 7654452-7657457 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1856 bp · TkA08G029900|TK1151|cDNA

CAAAAATCTGACCCCTATTATTCTCTGATGTCAAATAAATGCACTTAAAATGCAAACCCCAACTTGTAAGGTTTTTATGAACCCGCTCAAAGCGAGGTAAAGATAGGGAGCTGGGATAATGTTGATAACAGGAAGAGAACTTACATCTTCATGGTCTCTTTCTTGCCGCTTACCAAATCAATCCCGCAGTTCAATTCACGCCTCTAGAAATCTTCGAAACAATTCATCCATTTGCAGAGCAACACTTTCCGTCAACGGAA...

CDS

Download CDS FASTA

1635 bp · TkA08G029900|TK1151|CDS

ATGTTGATAACAGGAAGAGAACTTACATCTTCATGGTCTCTTTCTTGCCGCTTACCAAATCAATCCCGCAGTTCAATTCACGCCTCTAGAAATCTTCGAAACAATTCATCCATTTGCAGAGCAACACTTTCCGTCAACGGAAAACCCAACTCTCTCTTTTCATTATCTTCATCCACCAGCTGTGAGAGCTCTAATTTTGATCCGCTAGGTATCAATCCAGGTAAATTAGCGGGTCTAAATTCCACTTGGGACAGTATTGT...

Protein

Download Protein FASTA

544 aa · TkA08G029900|TK1151|PROTEIN

MLITGRELTSSWSLSCRLPNQSRSSIHASRNLRNNSSICRATLSVNGKPNSLFSLSSSTSCESSNFDPLGINPGKLAGLNSTWDSIVGLFSDRFDSNSSTRNDKSPSPKGAAAAIEDTSIDFGDFFKGPLPGKFLKLLGYLALSRLGIYIPLGGVNREAFVGNLDGNSILTTLDTFSGGGIGRLGICSLGIVPFINASIVFQLLTQIYPKLQELQKREGEAGRKKILQYTRYASVGFAVVQAIGQALFLRPYVDDFSTQW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G029900`
TK1151 ID	TkA08G029900
OH-1004 ID	LXL04_018066
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G029900

Location Chr08:7654452-7657457 (+)

Description Similar to SCY1: Preprotein translocase subunit SCY1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g18710`	Involved in protein export.	Plastids contain a second sec translocase system with essential functions.2011 · DOI: 10.1104/pp.110.166546

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0254500`	The central subunit of the protein translocation channel SecYE.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018066 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006616 SRP-dependent cotranslational protein targeting to membrane, translocation Biological Process

GO:0010027 thylakoid membrane organization Biological Process

GO:0015031 protein transport Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0005048 signal sequence binding Molecular Function

GO:0008320 protein transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT2G18710

dosa:Os08g0254500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.983

Rank 1 · TkA08G029900 · TK1151

Mitochondrion0.021

Rank 2 · TkA08G029900 · TK1151

Cell membrane0.011

Rank 3 · TkA08G029900 · TK1151

Nucleus0.010

Rank 4 · TkA08G029900 · TK1151

Cytoplasm0.010

Rank 5 · TkA08G029900 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00344SecY186-517 aa

PF06430L_lactis_RepB_C194-232 aa

PF17555TssN211-359 aa

PF12537GPHR_N464-530 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G029900	`PF00344`	SecY	186	517	1.5e-92	310.9
TkA08G029900	`PF06430`	L_lactis_RepB_C	194	232	0.21	12.4
TkA08G029900	`PF17555`	TssN	211	359	0.0031	17.8
TkA08G029900	`PF12537`	GPHR_N	464	530	0.21	12.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q38885`	Arabidopsis thaliana	sp\|Q38885\|SCY1_ARATH Preprotein translocase subunit SCY1, chloroplastic	84.700%	Swiss-Prot	High
`Q6ZG25`	Oryza sativa subsp. japonica	sp\|Q6ZG25\|SECY_ORYSJ Preprotein translocase subunit SECY, chloroplastic	82.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card