TkA08G028660 | RubberDandelionOmics

Gene overview

TkA08G028660

Reference: TK1151 Chr: Chr08 Coordinates: 7366033-7369860 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1715 bp · TkA08G028660|TK1151|cDNA

GGAGAGTGAGAGAGTAAGGTGGGGAACCATTTTCCTTAAATGCTTACTCTCCTCTTATTATAACCTCTCGTGCTTCCGTGCTGTGGCAACTCTGCTCTGTTTTCATCGGAACTCGTATCGCCGGCGTCCGGTCAAGTATGGCGTTGAAGTCTTTTGTAGAAGTTAAATTCGACTCACACTTCTCGATACATAACCTTCCATTCGGTGTTTTCAAGCATGGCGGAGACGATGCTGCTCCAAGGCCCGGAGTTGCAATTGGA...

CDS

Download CDS FASTA

1266 bp · TkA08G028660|TK1151|CDS

ATGGCGTTGAAGTCTTTTGTAGAAGTTAAATTCGACTCACACTTCTCGATACATAACCTTCCATTCGGTGTTTTCAAGCATGGCGGAGACGATGCTGCTCCAAGGCCCGGAGTTGCAATTGGAGATTACGTTCTCGATCTCTCAGCAATTCATTCCGCCGGTTTGTTTGACGGACCATTTCTTTGCAATTCCGACTGTTTCCATCAGTCAAATCTTAACAAGTTTCTGGAGCTGGGAAGACCAGCATGGAAGGAAGCTCG...

Protein

Download Protein FASTA

421 aa · TkA08G028660|TK1151|PROTEIN

MALKSFVEVKFDSHFSIHNLPFGVFKHGGDDAAPRPGVAIGDYVLDLSAIHSAGLFDGPFLCNSDCFHQSNLNKFLELGRPAWKEARSTLQKLLSYDEPALQNNASLKQKALLPMGEVEMVLPIAIGDYTDFFSSKHHAKNCGLIFRGPENPVNPNWFHLPIAYHGRASSIVISGTDIIRPRGQGHPSGNSPPYFGPSRKLDFELEMAAVVGPGNELGKPIDVNNAVDHIFGVVLMNDWSARDIQAWEYVPLGPFLGKSF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G028660`
TK1151 ID	TkA08G028660
OH-1004 ID	LXL04_018080
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G028660

Location Chr08:7366033-7369860 (+)

Description Similar to FAH: Fumarylacetoacetase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g12050`	Converts fumarylacetoacetate to acetoacetate and fumarate.	Disruption of fumarylacetoacetate hydrolase causes spontaneous cell death under short-day conditions in Arabidopsis.2013 · DOI: 10.1104/pp.113.216804 Sugar suppresses cell death caused by disruption of fumarylacetoacetate hydrolase in Arabidopsis.2016 · DOI: 10.1007/s00425-016-2530-6

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0196800`	Converts fumarylacetoacetate to acetoacetate and fumarate.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018080 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006527 L-arginine catabolic process Biological Process

GO:0006559 L-phenylalanine catabolic process Biological Process

GO:0006572 L-tyrosine catabolic process Biological Process

GO:0006629 lipid metabolic process Biological Process

GO:1902000 homogentisate catabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005829 cytosol Cellular Component

GO:0070062 extracellular exosome Cellular Component

GO:0004334 fumarylacetoacetase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G12050

bta:508724

dosa:Os02g0196800

hsa:2184

osa:4328618

rno:29383

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.583

Rank 1 · TkA08G028660 · TK1151

Nucleus0.348

Rank 2 · TkA08G028660 · TK1151

Mitochondrion0.113

Rank 3 · TkA08G028660 · TK1151

Peroxisome0.080

Rank 4 · TkA08G028660 · TK1151

Plastid0.064

Rank 5 · TkA08G028660 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09298FAA_hydrolase_N18-123 aa

PF01557FAA_hydrolase131-398 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G028660	`PF09298`	FAA_hydrolase_N	18	123	2.6e-33	115.0
TkA08G028660	`PF01557`	FAA_hydrolase	131	398	6e-40	137.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RW90`	Arabidopsis thaliana	sp\|Q8RW90\|FAH_ARATH Fumarylacetoacetase	76.600%	Swiss-Prot	High
`Q6H7M1`	Oryza sativa subsp. japonica	sp\|Q6H7M1\|FAH_ORYSJ Fumarylacetoacetase	70.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card