Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1055 bp · TkA08G022230|TK1151|cDNA
AATTACTTTAGCACTGGCCCAATAGTTGGACAGAAAAATAATAATCCCAAAGAGGAATTTAAGCAAATTTTTGAAACTTGAAGGGAGCTTATTGTAACTTTTTGTAATCCTAAACTTATTAGTTATCAATCAGATCAAACGTAAAACCACCACTCGGCAATCCCCAACATTCTCCCGCCTCCGTCGCCTCGCATCTCCGACCATCACTGTCACCGGCTAAGAAGCTCCGTTAGATTGCTCGTCATAGTCCACAAAACCCC...
795 bp · TkA08G022230|TK1151|CDS
ATGGTGCCTGCAAGCCTTCCAAAAACCAGTGGCTTACGGTTACTTTCCTACTGCAATCAAAGTTACATCAGTGGCCTCCCCCTTCGTCCACTTCTTTCCACATTCTCTTCACCATTAAAACCAAATGGACAACCACTCTCAACACTAAAAACTCCTCAAATATCCCCATTACAAATAGCATCAAAATCAACCAGATTCTTCTGCACATCCCAAACTGTATCCACAGACCCTTCCAGTTCCAGTTCCAGTTCTAGTCCTAC...
Protein
Download Protein FASTA264 aa · TkA08G022230|TK1151|PROTEIN
MVPASLPKTSGLRLLSYCNQSYISGLPLRPLLSTFSSPLKPNGQPLSTLKTPQISPLQIASKSTRFFCTSQTVSTDPSSSSSSSSPTSTSTPTTTEENKEAVVDMMKIKDMANTLDIRVGKILKAWRHEEADSLYVEEVDIGEPEPRIICSGLVKYIPLEQLQNKNVIVLANLKPRNMRGVKSFGMLMAASDKSHENVELLEPPEGVELGERIWFGIGGEDEKEKLPEAASANQVAKKKIWEQVQPHLSTTGSCVATLGD...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G022230 |
|---|---|
| TK1151 ID | TkA08G022230 |
| OH-1004 ID | LXL04_018177 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 98.400 |
| Protein coverage (%) | TK1151 70.833 / OH-1004 47.222Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G022230 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr08:5604983-5611763 (+) | ||||||||||||
| Description | Similar to Aimp1: Aminoacyl tRNA synthase complex-interacting multifunctional protein 1 | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0001937 negative regulation of endothelial cell proliferation Biological Process GO:0006412 translation Biological Process GO:0006418 tRNA aminoacylation for protein translation Biological Process GO:0006431 methionyl-tRNA aminoacylation Biological Process GO:0006437 tyrosyl-tRNA aminoacylation Biological Process GO:0007267 cell-cell signaling Biological Process GO:0009791 post-embryonic development Biological Process GO:0042594 response to starvation Biological Process GO:0048608 reproductive structure development Biological Process GO:0051607 defense response to virus Biological Process GO:0070094 positive regulation of glucagon secretion Biological Process GO:0005615 extracellular space Cellular Component | ||||||||||||
| KEGG gene cross-reference | cge:100689238 hsa:9255 mmu:13722 rno:313047 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF24544Ig_TPPC8_2nd54-117 aaPF01588tRNA_bind117-212 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA08G022230 | PF24544 | Ig_TPPC8_2nd | 54 | 117 | 0.15 | 13.4 |
| TkA08G022230 | PF01588 | tRNA_bind | 117 | 212 | 1.2e-31 | 109.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.